Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C12orf59 cdna clone

C12orf59 cDNA Clone

Gene Names
TMEM52B; C12orf59
Synonyms
C12orf59; C12orf59 cDNA Clone; C12orf59 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGAGTCCGAGTTCATGTCGTGGCGGCCTCAGCCCTGCTGTATTTCATCCTGCTTTCTGGGACGAGATGTGAGGAAAACTGTGGTAATCCTGAACATTGCCTGACCACAGACTGGGTACATCTCTGGTATATATGGTTGCTAGTGGTAATTGGCGCGCTGCTTCTCCTGTGTGGCCTGACGTCCCTGTGCTTCCGCTGCTGCTGTCTGAGCCGCCAGCAAAATGGGGAAGATGGGGGCCCACCACCCTGTGAAGTGACCGTCATTGCTTTCGATCACGACAGCACTCTCCAGAGCACTATCACATCTCTGCAGTCGGTGTTTGGCCCTGCAGCTCGGAGGATCCTGGCTGTGGCTCACTCCCACAGCTCCCTGGGCCAGCTGCCCTCCTCTTTGGACACCCTCCCAGGGTATGAAGAAGCTCTTCACATGAGTCGCTTCACAGTAGCCATGTGCGGGCAGAAAGCACCTGATCTACCCCCAGTACCTGAAGAAAAGCAGCTGCCTCCAACAGAGAAGGAGTCGACTCGAATAGTTGACTCTTGGAACTGA
Sequence Length
552
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,913 Da
NCBI Official Full Name
Homo sapiens chromosome 12 open reading frame 59, mRNA
NCBI Official Synonym Full Names
transmembrane protein 52B
NCBI Official Symbol
TMEM52B
NCBI Official Synonym Symbols
C12orf59
NCBI Protein Information
transmembrane protein 52B
UniProt Protein Name
Transmembrane protein 52B
UniProt Gene Name
TMEM52B
UniProt Synonym Gene Names
C12orf59
UniProt Entry Name
TM52B_HUMAN

Uniprot Description

TMEM52B: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.2

Similar Products

Product Notes

The C12orf59 tmem52b (Catalog #AAA1268674) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGAGTCC GAGTTCATGT CGTGGCGGCC TCAGCCCTGC TGTATTTCAT CCTGCTTTCT GGGACGAGAT GTGAGGAAAA CTGTGGTAAT CCTGAACATT GCCTGACCAC AGACTGGGTA CATCTCTGGT ATATATGGTT GCTAGTGGTA ATTGGCGCGC TGCTTCTCCT GTGTGGCCTG ACGTCCCTGT GCTTCCGCTG CTGCTGTCTG AGCCGCCAGC AAAATGGGGA AGATGGGGGC CCACCACCCT GTGAAGTGAC CGTCATTGCT TTCGATCACG ACAGCACTCT CCAGAGCACT ATCACATCTC TGCAGTCGGT GTTTGGCCCT GCAGCTCGGA GGATCCTGGC TGTGGCTCAC TCCCACAGCT CCCTGGGCCA GCTGCCCTCC TCTTTGGACA CCCTCCCAGG GTATGAAGAA GCTCTTCACA TGAGTCGCTT CACAGTAGCC ATGTGCGGGC AGAAAGCACC TGATCTACCC CCAGTACCTG AAGAAAAGCA GCTGCCTCCA ACAGAGAAGG AGTCGACTCG AATAGTTGAC TCTTGGAACT GA. It is sometimes possible for the material contained within the vial of "C12orf59, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.