Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C12orf39 cdna clone

C12orf39 cDNA Clone

Gene Names
SPX; C12orf39
Synonyms
C12orf39; C12orf39 cDNA Clone; C12orf39 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagggactcagaagtctggcagcaacaaccttggctcttttcctggtgtttgttttcctgggaaactccagctgcgctccgcagagactgttggagagaaggaactggactcctcaagctatgctctacctgaaaggggcacagggtcgccgcttcatctccgaccagagccggagaaaggacctctccgaccggccactgccggaaagacgaagcccaaatccccaactactaactattccggaggcagcaaccatcttactggcgtcccttcagaaatcaccagaagatgaagaaaaaaactttgatcaaaccagattcctggaagacagtctgcttaactggtga
Sequence Length
351
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,302 Da
NCBI Official Full Name
Homo sapiens chromosome 12 open reading frame 39, mRNA
NCBI Official Synonym Full Names
spexin hormone
NCBI Official Symbol
SPX
NCBI Official Synonym Symbols
C12orf39
NCBI Protein Information
spexin
UniProt Protein Name
Spexin
UniProt Gene Name
SPX
UniProt Synonym Gene Names
C12orf39
UniProt Entry Name
SPXN_HUMAN

NCBI Description

The protein encoded by this gene is a hormone involved in modulation of cardiovascular and renal function. It has also been shown in rats to cause weight loss. Several transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]

Uniprot Description

SPX: Induces contraction of stomach muscle.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 12p12.1

Cellular Component: extracellular space

Biological Process: negative regulation of appetite; negative regulation of heart rate; positive regulation of systemic arterial blood pressure; regulation of sensory perception of pain

Research Articles on C12orf39

Similar Products

Product Notes

The C12orf39 spx (Catalog #AAA1274640) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagggac tcagaagtct ggcagcaaca accttggctc ttttcctggt gtttgttttc ctgggaaact ccagctgcgc tccgcagaga ctgttggaga gaaggaactg gactcctcaa gctatgctct acctgaaagg ggcacagggt cgccgcttca tctccgacca gagccggaga aaggacctct ccgaccggcc actgccggaa agacgaagcc caaatcccca actactaact attccggagg cagcaaccat cttactggcg tcccttcaga aatcaccaga agatgaagaa aaaaactttg atcaaaccag attcctggaa gacagtctgc ttaactggtg a. It is sometimes possible for the material contained within the vial of "C12orf39, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.