C11orf80 cdna clone
C11orf80 cDNA Clone
Gene Names
C11orf80; TOP6BL; TOPOVIBL
Synonyms
C11orf80; C11orf80 cDNA Clone; C11orf80 cdna clone
Sequence
atggttgcttctgcaggaagcctttttggtggcatggtcctcaagaagttcctaaaagaaatacagtccatactgcccggaatctctgcaaagctgacttggacttcagaggaaggcagctattctcaggatatgacaggggtaacacccttccagatgatttttgaggttgatgaaaagcccagaaccttgatgacagattgtctggttataaagcattttttacgtaaaatcatcatggtgcaccctaaggtcagatttcatttcagtgtaaaggtaaatggaatcctctccacagagatctttggggtggagaatgaacccactttgaaccttgggaatggaattgctcttttggtcgactcccagcattatgtgagaccaaattttggtacaattgaatcacactgcagcagaattcaccctgtgctaggacatccagtaatgcttttcatccctgaagacgtggctggcatggacttgttgggagaactgatactgactccagcagctgcactgtgccccagcccaaaggtttcttccaaccagcttaacaggatttcttcagtttccatatttctatatggacctttgggtctgcctctgatattgtcaacttgggagcagccgatgactactttcttcaaagatacctcttctttagttgactggaaaaaataccatttgtgtatgatacccaatttggatctcaatttggatagagatttggtgcttccagatgtgagttatcaggtggaatccagtgaggaggatcagtctcagactatggatcctcaaggacaaactctgctgctttttctctttgtggatttccacagtgcatttccagtccagcaaatggaaatctggggagtctatactttgctcacaactcatctcaatgccatccttgtggagagccacagtgtagtgcaaggttccatccaattcactgtggacaaggtcttggagcaacatcaccaggctgccaaggctcagcagaaactacaggcctcactctcagtggctgtgaactccatcatgagtattctgactggaagcactaggagcagcttccgaaagatgtgtctccagacccttcaagcagctgacacacaagagttcaggaccaaactgcacaaagtatttcgtgagatcacccaacaccaatttcttcaccactgctcatgtgaggtgaagcagcagctaaccctagaaaaaaaggactcagcccagggcactgaggacgcacctgataacagcagcctggagctcctagcagataccagcgggcaagcagaaaacaagaggctcaagaggggcagcccccgcatagaggagatgcgagctctgcgctctgccagggccccgagcccgtcagaggccgccccgcgccgcccggaagccaccgcggcccccctcactcctagaggaagggagcaccgcgaggctcacggcagggccctggcgccgggcagggcgagcctcggaagccgcctggaggacgtgctgtggctgcaggaggtctccaacctgtcagagtggctgagtcccagccctgggccctga
Sequence Length
1569
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,512 Da
NCBI Official Full Name
Homo sapiens chromosome 11 open reading frame 80, mRNA
NCBI Official Synonym Full Names
chromosome 11 open reading frame 80
NCBI Official Symbol
C11orf80
NCBI Official Synonym Symbols
TOP6BL; TOPOVIBL
NCBI Protein Information
type 2 DNA topoisomerase 6 subunit B-like
UniProt Protein Name
Type 2 DNA topoisomerase 6 subunit B-like
UniProt Gene Name
TOP6BL
UniProt Synonym Gene Names
TOPOVIBL
UniProt Entry Name
TO6BL_HUMAN
Uniprot Description
C11orf80 iso4: Component of a topoisomerase 6 complex specifically required for meiotic recombination. Together with SPO11, mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination. The complex promotes relaxation of negative and positive supercoiled DNA and DNA decatenation through cleavage and ligation cycles. Despite a weak sequence similarity, retains most of the structural features of the ancestral archaeal Top6B subunit (AC O05207), including the transducer domain that interacts with the SPO11 subunit and the ATP-binding fold, also named GHKL fold. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 11q13.2
Biological Process: meiotic DNA double-strand break formation; meiotic recombination
Similar Products
Product Notes
The C11orf80 top6bl (Catalog #AAA1269412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttgctt ctgcaggaag cctttttggt ggcatggtcc tcaagaagtt cctaaaagaa atacagtcca tactgcccgg aatctctgca aagctgactt ggacttcaga ggaaggcagc tattctcagg atatgacagg ggtaacaccc ttccagatga tttttgaggt tgatgaaaag cccagaacct tgatgacaga ttgtctggtt ataaagcatt ttttacgtaa aatcatcatg gtgcacccta aggtcagatt tcatttcagt gtaaaggtaa atggaatcct ctccacagag atctttgggg tggagaatga acccactttg aaccttggga atggaattgc tcttttggtc gactcccagc attatgtgag accaaatttt ggtacaattg aatcacactg cagcagaatt caccctgtgc taggacatcc agtaatgctt ttcatccctg aagacgtggc tggcatggac ttgttgggag aactgatact gactccagca gctgcactgt gccccagccc aaaggtttct tccaaccagc ttaacaggat ttcttcagtt tccatatttc tatatggacc tttgggtctg cctctgatat tgtcaacttg ggagcagccg atgactactt tcttcaaaga tacctcttct ttagttgact ggaaaaaata ccatttgtgt atgataccca atttggatct caatttggat agagatttgg tgcttccaga tgtgagttat caggtggaat ccagtgagga ggatcagtct cagactatgg atcctcaagg acaaactctg ctgctttttc tctttgtgga tttccacagt gcatttccag tccagcaaat ggaaatctgg ggagtctata ctttgctcac aactcatctc aatgccatcc ttgtggagag ccacagtgta gtgcaaggtt ccatccaatt cactgtggac aaggtcttgg agcaacatca ccaggctgcc aaggctcagc agaaactaca ggcctcactc tcagtggctg tgaactccat catgagtatt ctgactggaa gcactaggag cagcttccga aagatgtgtc tccagaccct tcaagcagct gacacacaag agttcaggac caaactgcac aaagtatttc gtgagatcac ccaacaccaa tttcttcacc actgctcatg tgaggtgaag cagcagctaa ccctagaaaa aaaggactca gcccagggca ctgaggacgc acctgataac agcagcctgg agctcctagc agataccagc gggcaagcag aaaacaagag gctcaagagg ggcagccccc gcatagagga gatgcgagct ctgcgctctg ccagggcccc gagcccgtca gaggccgccc cgcgccgccc ggaagccacc gcggcccccc tcactcctag aggaagggag caccgcgagg ctcacggcag ggccctggcg ccgggcaggg cgagcctcgg aagccgcctg gaggacgtgc tgtggctgca ggaggtctcc aacctgtcag agtggctgag tcccagccct gggccctga. It is sometimes possible for the material contained within the vial of "C11orf80, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
