Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C11orf49 cdna clone

C11orf49 cDNA Clone

Synonyms
C11orf49; C11orf49 cDNA Clone; C11orf49 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgagtccggagcgcctagccctaccggactacgagtatctggctcagcgacatgtcctcacctacatggaggatgcagtgtgccagctgctagaaaacagggaagatattagccaatatggaattgccaggttcttcactgaatattttaacagtgtatgccagggaacacacattctctttcgagaattcagcttcgtccaagccaccccccacaatagggtatcatttttacgggccttctggagatgcttccgaactgtgggcaaaaatggcgatttgctgaccatgaaagaatatcactgtttgctgcaattactgtgtcctgatttcccgctggagctcactcagaaagcagccaggattgtgctcatggacgatgccatggactgcttgatgtctttttcagatttcctctttgccttccagatccagttttactactcagaattcctggacagtgtggctgccatctatgaggacctgctgtcaggcaagaaccccaacacagtgattgtgccgacgtcgtccagtgggcagcaccgccaacgacctgccttgggcggggccggcacgctggagggcgtggaggcgtcgctgttctaccagtgtctggaaaacctgtgtgatcggcacaagtacagctgcccacccccagcacttgtcaaagaggccctcagcaatgttcagagactgaccttctatggattcctcatggctctctcaaagcaccgtggaatcaaccaagccctcggagctttgcctgacaagggggatctgatgcacgacccagcaatggatgaagagctggaacggctgcttcttcccttcttcaggctggcccaggtcccaggcctggtcaactcggtcacagccagtccagaggccagttgcctgccttcccggacccctccccgggttggctctccctggagacctctccatcattcccgaaaagtggatggagagagtgatggctccactgaagagacagacgagtcggagacttga
Sequence Length
1014
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,531 Da
NCBI Official Full Name
Homo sapiens chromosome 11 open reading frame 49, mRNA
NCBI Official Synonym Full Names
chromosome 11 open reading frame 49
NCBI Official Symbol
C11orf49
NCBI Protein Information
UPF0705 protein C11orf49
UniProt Protein Name
UPF0705 protein C11orf49
Protein Family
UniProt Gene Name
C11orf49
UniProt Entry Name
CK049_HUMAN

Uniprot Description

MGC4707: Belongs to the UPF0705 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: nucleoplasm

Molecular Function: protein binding

Research Articles on C11orf49

Similar Products

Product Notes

The C11orf49 c11orf49 (Catalog #AAA1273695) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagtc cggagcgcct agccctaccg gactacgagt atctggctca gcgacatgtc ctcacctaca tggaggatgc agtgtgccag ctgctagaaa acagggaaga tattagccaa tatggaattg ccaggttctt cactgaatat tttaacagtg tatgccaggg aacacacatt ctctttcgag aattcagctt cgtccaagcc accccccaca atagggtatc atttttacgg gccttctgga gatgcttccg aactgtgggc aaaaatggcg atttgctgac catgaaagaa tatcactgtt tgctgcaatt actgtgtcct gatttcccgc tggagctcac tcagaaagca gccaggattg tgctcatgga cgatgccatg gactgcttga tgtctttttc agatttcctc tttgccttcc agatccagtt ttactactca gaattcctgg acagtgtggc tgccatctat gaggacctgc tgtcaggcaa gaaccccaac acagtgattg tgccgacgtc gtccagtggg cagcaccgcc aacgacctgc cttgggcggg gccggcacgc tggagggcgt ggaggcgtcg ctgttctacc agtgtctgga aaacctgtgt gatcggcaca agtacagctg cccaccccca gcacttgtca aagaggccct cagcaatgtt cagagactga ccttctatgg attcctcatg gctctctcaa agcaccgtgg aatcaaccaa gccctcggag ctttgcctga caagggggat ctgatgcacg acccagcaat ggatgaagag ctggaacggc tgcttcttcc cttcttcagg ctggcccagg tcccaggcct ggtcaactcg gtcacagcca gtccagaggc cagttgcctg ccttcccgga cccctccccg ggttggctct ccctggagac ctctccatca ttcccgaaaa gtggatggag agagtgatgg ctccactgaa gagacagacg agtcggagac ttga. It is sometimes possible for the material contained within the vial of "C11orf49, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.