C11orf46 cdna clone
C11orf46 cDNA Clone
Gene Names
ARL14EP; ARF7EP; C11orf46; dJ299F11.1
Synonyms
C11orf46; C11orf46 cDNA Clone; C11orf46 cdna clone
Sequence
atgatggatccatgttcagttggagtccagcttcgtactacaaatgagtgccataaaacctactatactcgtcacacaggttttaagactttgcaagaattgtcatcaaatgatatgcttttacttcaacttagaactggaatgacactttctgggaacaatacaatttgctttcatcatgtaaaaatttacattgacagatttgaggatttacagaagtcatgttgtgacccatttaacatacacaagaaattagccaaaaaaaatttgcatgtaattgacttagatgatgccacttttctgagtgctaaatttggaagacagcttgtacctggttggaagctttgtccaaaatgcacacagataatcaatggaagtgtggatgttgatactgaagaccgccagaaaaggaaacctgagtcagatggaagaactgctaaagctttgaggtcattacaatttacgaatccaggaaggcaaactgaatttgctccagaaactggtaaaagagaaaaaagaaggcttacaaaaaatgcaaccgctggttcagacagacaagtgataccagcaaagagtaaggtctatgatagccagggtctcctgatttttagtgggatggacctctgtgactgcctggatgaagactgcttaggatgtttctatgcttgtcctgcctgtggttctaccaagtgtggagctgaatgccgctgtgaccgcaagtggctgtatgagcaaattgaaattgaaggaggagaaataattcataataaacatgctggataa
Sequence Length
783
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,338 Da
NCBI Official Full Name
Homo sapiens chromosome 11 open reading frame 46, mRNA
NCBI Official Synonym Full Names
ADP ribosylation factor like GTPase 14 effector protein
NCBI Official Symbol
ARL14EP
NCBI Official Synonym Symbols
ARF7EP; C11orf46; dJ299F11.1
NCBI Protein Information
ARL14 effector protein
UniProt Protein Name
ARL14 effector protein
UniProt Gene Name
ARL14EP
UniProt Synonym Gene Names
ARF7EP; C11orf46
UniProt Entry Name
AL14E_HUMAN
NCBI Description
The protein encoded by this gene is an effector protein. It interacts with ADP-ribosylation factor-like 14 [ARL14, also known as ADP-ribosylation factor 7 (ARF7)], beta-actin (ACTB) and actin-based motor protein myosin 1E (MYO1E). ARL14 is a small GTPase; it controls the export of major histocompatibility class II molecules by connecting to the actin network via this effector protein. [provided by RefSeq, Sep 2014]
Uniprot Description
ARL14EP: Through its interaction with ARL14 and MYO1E, may connect MHC class II-containing cytoplasmic vesicles to the actin network and hence controls the movement of these vesicles along the actin cytoskeleton in dendritic cells.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 11p14.1
Molecular Function: protein binding
Similar Products
Product Notes
The C11orf46 arl14ep (Catalog #AAA1273914) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggatc catgttcagt tggagtccag cttcgtacta caaatgagtg ccataaaacc tactatactc gtcacacagg ttttaagact ttgcaagaat tgtcatcaaa tgatatgctt ttacttcaac ttagaactgg aatgacactt tctgggaaca atacaatttg ctttcatcat gtaaaaattt acattgacag atttgaggat ttacagaagt catgttgtga cccatttaac atacacaaga aattagccaa aaaaaatttg catgtaattg acttagatga tgccactttt ctgagtgcta aatttggaag acagcttgta cctggttgga agctttgtcc aaaatgcaca cagataatca atggaagtgt ggatgttgat actgaagacc gccagaaaag gaaacctgag tcagatggaa gaactgctaa agctttgagg tcattacaat ttacgaatcc aggaaggcaa actgaatttg ctccagaaac tggtaaaaga gaaaaaagaa ggcttacaaa aaatgcaacc gctggttcag acagacaagt gataccagca aagagtaagg tctatgatag ccagggtctc ctgattttta gtgggatgga cctctgtgac tgcctggatg aagactgctt aggatgtttc tatgcttgtc ctgcctgtgg ttctaccaag tgtggagctg aatgccgctg tgaccgcaag tggctgtatg agcaaattga aattgaagga ggagaaataa ttcataataa acatgctgga taa. It is sometimes possible for the material contained within the vial of "C11orf46, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
