Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BTNL9 cdna clone

BTNL9 cDNA Clone

Gene Names
BTNL9; BTN3; BTN8; VDLS1900
Synonyms
BTNL9; BTNL9 cDNA Clone; BTNL9 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggacctctcagtctccccagactccttgaagccagtatcgctgaccagcagtcttgtcttcctcatgcacctcctcctccttcagcctggggagccgagctcagaggtcaaggtgctaggccctgagtatcccatcctggccctcgtcggggaggaggtggagttcccgtgccacctatggccacagctggatgcccagcaaatggagatccgctggttccggagtcagaccttcaatgtggtacacctgtaccaggagcagcaggagctccctggcaggcagatgccggcgttccggaacaggaccaagttggtcaaggacgacatcgcctatggcagcgtggtcctgcagcttcacagcatcatcccctctgacaagggcacatatggctgccgcttccactccgacaacttctctggcgaagctctctgggaactggaggtagcagggctgggctcagaccctcacctctcccttgagggcttcaaggaaggaggcattcagctgaggctcagatccagtggctggtaccccaagcctaaggttcagtggagagaccaccagggacagtgcctgcctccagagtttgaagccatcgtctgggatgcccaggacctgttcagtctggaaacatctgtggttgtccgagcgggagccctcagcaatgtgtccgtctccatccagaatctcctcttgagccagaagaaagagttggtggtccagatagcagacgtgttcgtacccggagcctctgcgtggaagagcgcgttcgtcgcgaccctgccgctgctgttggtcctcgcggcgctggcgctgggcgtcctccggaagcagcggagaagccgagaaaagctgaggaagcaggcggagaagagacaagagaaactcactgcagagctggaaaagcttcagacagagcttgactggagacgggctgaaggccaggctgagtgcttcgttttagccagccaccctcctggagaaggtatccaggctgcctctaactccacaacaacactgaatgcatag
Sequence Length
1035
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,382 Da
NCBI Official Full Name
Homo sapiens butyrophilin-like 9, mRNA
NCBI Official Synonym Full Names
butyrophilin like 9
NCBI Official Symbol
BTNL9
NCBI Official Synonym Symbols
BTN3; BTN8; VDLS1900
NCBI Protein Information
butyrophilin-like protein 9
UniProt Protein Name
Butyrophilin-like protein 9
Protein Family
UniProt Gene Name
BTNL9
UniProt Entry Name
BTNL9_HUMAN

Uniprot Description

BTNL9: Belongs to the immunoglobulin superfamily. BTN/MOG family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Immunoglobulin superfamily

Chromosomal Location of Human Ortholog: 5q35.3

Similar Products

Product Notes

The BTNL9 btnl9 (Catalog #AAA1266782) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggacc tctcagtctc cccagactcc ttgaagccag tatcgctgac cagcagtctt gtcttcctca tgcacctcct cctccttcag cctggggagc cgagctcaga ggtcaaggtg ctaggccctg agtatcccat cctggccctc gtcggggagg aggtggagtt cccgtgccac ctatggccac agctggatgc ccagcaaatg gagatccgct ggttccggag tcagaccttc aatgtggtac acctgtacca ggagcagcag gagctccctg gcaggcagat gccggcgttc cggaacagga ccaagttggt caaggacgac atcgcctatg gcagcgtggt cctgcagctt cacagcatca tcccctctga caagggcaca tatggctgcc gcttccactc cgacaacttc tctggcgaag ctctctggga actggaggta gcagggctgg gctcagaccc tcacctctcc cttgagggct tcaaggaagg aggcattcag ctgaggctca gatccagtgg ctggtacccc aagcctaagg ttcagtggag agaccaccag ggacagtgcc tgcctccaga gtttgaagcc atcgtctggg atgcccagga cctgttcagt ctggaaacat ctgtggttgt ccgagcggga gccctcagca atgtgtccgt ctccatccag aatctcctct tgagccagaa gaaagagttg gtggtccaga tagcagacgt gttcgtaccc ggagcctctg cgtggaagag cgcgttcgtc gcgaccctgc cgctgctgtt ggtcctcgcg gcgctggcgc tgggcgtcct ccggaagcag cggagaagcc gagaaaagct gaggaagcag gcggagaaga gacaagagaa actcactgca gagctggaaa agcttcagac agagcttgac tggagacggg ctgaaggcca ggctgagtgc ttcgttttag ccagccaccc tcctggagaa ggtatccagg ctgcctctaa ctccacaaca acactgaatg catag. It is sometimes possible for the material contained within the vial of "BTNL9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.