Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BSND cdna clone

BSND cDNA Clone

Gene Names
BSND; BART; DFNB73
Synonyms
BSND; BSND cDNA Clone; BSND cdna clone
Ordering
For Research Use Only!
Sequence
atggctgacgagaagaccttccggatcggcttcattgtgctggggcttttcctgctggccctcggtacgttcctcatgagccatgatcggccccaggtctacggcaccttctatgccatgggcagcgtcatggtgatcgggggcatcatctggagcatgtgccagtgctaccccaagatcaccttcgtccctgctgactctgactttcaaggcatcctctccccaaaggccatgggcctgctggagaatgggcttgctgccgagatgaagagccccagtccccagccgccctatgtaaggctgtgggaggaagccgcctatgaccagagcctgcctgacttcagccacatccagatgaaagtcatgagctacagtgaggaccaccgctccttgctggccctgagatggggcagccgaagctgggaaccagtgatggaggagaaggtggcctggcgacgttcaggcctggatggaggctgccgtggtcatccacaagggctcagacgagagtga
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,197 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:7262367, containing frame-shift errors
NCBI Official Synonym Full Names
barttin CLCNK type accessory beta subunit
NCBI Official Symbol
BSND
NCBI Official Synonym Symbols
BART; DFNB73
NCBI Protein Information
barttin
UniProt Protein Name
Barttin
Protein Family
UniProt Gene Name
BSND
UniProt Synonym Gene Names
BART
UniProt Entry Name
BSND_HUMAN

NCBI Description

This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]

Uniprot Description

BSND: Functions as a beta-subunit for CLCNKA and CLCNKB chloride channels. In the kidney CLCNK/BSND heteromers mediate chloride reabsorption by facilitating its basolateral efflux. In the stria, CLCNK/BSND channels drive potassium secretion by recycling chloride for the basolateral SLC12A2 cotransporter. Defects in BSND are the cause of Bartter syndrome type 4A (BS4A); also known as infantile Bartter syndrome with sensorineural deafness. BS refers to a group of autosomal recessive disorders characterized by impaired salt reabsorption in the thick ascending loop of Henle with pronounced salt wasting, hypokalemic metabolic alkalosis, and varying degrees of hypercalciuria. BS4A is associated with sensorineural deafness.

Protein type: Transporter; Membrane protein, integral; Membrane protein, multi-pass; Transporter, ion channel

Chromosomal Location of Human Ortholog: 1p32.1

Cellular Component: basolateral plasma membrane; integral to plasma membrane; plasma membrane; protein complex

Molecular Function: chloride channel activity; voltage-gated chloride channel activity

Disease: Bartter Syndrome, Type 4a

Research Articles on BSND

Similar Products

Product Notes

The BSND bsnd (Catalog #AAA1278681) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgacg agaagacctt ccggatcggc ttcattgtgc tggggctttt cctgctggcc ctcggtacgt tcctcatgag ccatgatcgg ccccaggtct acggcacctt ctatgccatg ggcagcgtca tggtgatcgg gggcatcatc tggagcatgt gccagtgcta ccccaagatc accttcgtcc ctgctgactc tgactttcaa ggcatcctct ccccaaaggc catgggcctg ctggagaatg ggcttgctgc cgagatgaag agccccagtc cccagccgcc ctatgtaagg ctgtgggagg aagccgccta tgaccagagc ctgcctgact tcagccacat ccagatgaaa gtcatgagct acagtgagga ccaccgctcc ttgctggccc tgagatgggg cagccgaagc tgggaaccag tgatggagga gaaggtggcc tggcgacgtt caggcctgga tggaggctgc cgtggtcatc cacaagggct cagacgagag tga. It is sometimes possible for the material contained within the vial of "BSND, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.