Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BRD8 cdna clone

BRD8 cDNA Clone

Gene Names
BRD8; SMAP; p120; SMAP2
Synonyms
BRD8; BRD8 cDNA Clone; BRD8 cdna clone
Ordering
For Research Use Only!
Sequence
atgagaagtggcgatcaaaattgggtatcagttagcagagcaatcaagccctttgcagaacctggccgccctccagactggttctctcaaaaacattgtgcttcccagtactcggagcttttagagaccactgagacaccaaaacggaaacgaggtgaaaagggagaagtggtggaaactgttgaagatgttattgttcggaaattgactgctgagcgagttgaagaactaaagaaagtgataaaggaaacccaggagagatatagacggctaaagagagatgcagaactaattcaagctggacacatggacagcagactggatgagctttgcaatgacattgcaacgaaaaagaaattggaagaagaggaggctgaagtaaagaggaaggctacagatgctgcataccaggctcgtcaagcagtaaaaacacccccccggaggttacccactgtgatggttcgctctcctatagattctgcctccccaggaggtgattatccacttggggacttgactccaaccactatggaagaggctacctctggggtaacccccgggactttgccgagtaccccagtcacctcgtttcctgggattcctgacacccttcctccaggctctgcacccttagaagcccccatgaccccagtaacagatgattcaccccagaaaaagatgcttggacagaaagcaactccacccccctcccctctgctgtcagagctcttgaagaagggcagcctcctgcctactagccccagactggtcaatgagagtgaaatggctgtggcttctggccacctgaacagtacaggtgtcctcctggaggtaggcggggtccttcccatgatacatggtggggagatacagcaaacacccaatactgttgcagcctcccctgctgcatcaggtgctcccactctttcccggcttttagaagctggtcctacacagttcaccacacctcttgcttccttcactactgttgccagtgagcctccagttaaacttgtgccaccccctgtagagtctgtgtcccaagctaccattgtcatgatgcctgcgctgccagcaccatcctctgctccggctgtctccactactgaaagtgtagctccagtgagtcaacccgacaactgtgttcccatggaggctgtgggggatccacatactgtgactgtttccatggacagcagtgaaatatccatgatcatcaattctatcaaagaagagtgttttcgatcaggggtagcagaggctcctgttggatcaaaggctcccagcatagatgggaaggaagaattagatctggctgagaagatggatattgctgtgtcttacacaggtgaagagctggattttgagactgttggagacatcattgccatcattgaggacaaggtagatgatcatcctgaagtgctggatgtggcagcagtggaagcagcactgtcattttgtgaagaaaatgatgatcctcagtccctgcctggcccctgggagcatcctatccagcaggagcgggacaagccagtacctctccctgcaccagaaatgacggtcaagcaagagagactggactttgaggaaacggaaaacaagggaatacatgaactggtggacatcagggagcccagtgcagagatcaaggtggaacctgcagaaccagagccagtcatttcaggagccgaaatagtagctggagttgttccagccacaagtatggagccaccagaactcaggagtcaggacttagatgaggaactgggaagtactgcagctggagagattgttgaagcagatgttgccattgggaaaggcgatgagactccacttacaaatgtgaagacagaggcatcccctgaaagcatgttgtctccatcacatggctcaaatcccattgaagatcctttagaggcagagactcagcacaagtttgaaatgtcagactcattgaaagaagaatcagggactatttttggaagccagataaaggatgccccaggtgaggatgaggaggaagatggtgtcagtgaagcggccagcctagaggagcctaaggaagaggatcaaggagaaggctacttgtcagaaatggataatgaacctcctgtgagcgagagtgatgatggcttcagcatacacaatgctacactgcagtcacacacactggcagactccatccccagcagccctgcttcttcacagttctctgtctgtagtgaggatcaggaagctattcaggcacagaaaatttggaagaaagccatcatgcttgtatggagagctgcagctaatcataggtatgccaatgtcttcctgcagcctgttacagatgacatagcacctggctaccacagcattgtgcagaggcctatggatttgtcaactattaagaaaaacatagaaaatggactgatccgaagcacagctgaatttcagcgtgacattatgctgatgtttcagaatgctgtaatgtacaatagctcagaccatgatgtctatcacatggcagtggagatgcagcgagatgtcttggaacagatccagcaattcttggccacgcagttgattatgcaaacatccgagtctgggatcagtgctaaaagtcttcgagggagagattctacccgcaaacaggatgcttcagagaaggacagtgtcccaatgggctctcctgccttccttctctctctctttgatggaggaaccaggggacgccgctgtgccattgaagcagatatgaagatgaaaaagtga
Sequence Length
2763
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
94,297 Da
NCBI Official Full Name
Homo sapiens bromodomain containing 8, mRNA
NCBI Official Synonym Full Names
bromodomain containing 8
NCBI Official Symbol
BRD8
NCBI Official Synonym Symbols
SMAP; p120; SMAP2
NCBI Protein Information
bromodomain-containing protein 8
UniProt Protein Name
Bromodomain-containing protein 8
UniProt Gene Name
BRD8
UniProt Synonym Gene Names
SMAP; SMAP2; TrCP120
UniProt Entry Name
BRD8_HUMAN

NCBI Description

The protein encoded by this gene interacts with thyroid hormone receptor in a ligand-dependent manner and enhances thyroid hormone-dependent activation from thyroid response elements. This protein contains a bromodomain and is thought to be a nuclear receptor coactivator. Multiple alternatively spliced transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2014]

Uniprot Description

BRD8 iso1: May act as a coactivator during transcriptional activation by hormone-activated nuclear receptors (NR). Isoform 2 stimulates transcriptional activation by AR/DHTR, ESR1/NR3A1, RXRA/NR2B1 and THRB/ERBA2. At least isoform 1 and isoform 2 are components of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: mitochondrion; NuA4 histone acetyltransferase complex; nucleoplasm

Molecular Function: thyroid hormone receptor activity

Biological Process: cell surface receptor linked signal transduction; regulation of transcription from RNA polymerase II promoter; signal transduction

Research Articles on BRD8

Similar Products

Product Notes

The BRD8 brd8 (Catalog #AAA1267836) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaagtg gcgatcaaaa ttgggtatca gttagcagag caatcaagcc ctttgcagaa cctggccgcc ctccagactg gttctctcaa aaacattgtg cttcccagta ctcggagctt ttagagacca ctgagacacc aaaacggaaa cgaggtgaaa agggagaagt ggtggaaact gttgaagatg ttattgttcg gaaattgact gctgagcgag ttgaagaact aaagaaagtg ataaaggaaa cccaggagag atatagacgg ctaaagagag atgcagaact aattcaagct ggacacatgg acagcagact ggatgagctt tgcaatgaca ttgcaacgaa aaagaaattg gaagaagagg aggctgaagt aaagaggaag gctacagatg ctgcatacca ggctcgtcaa gcagtaaaaa cacccccccg gaggttaccc actgtgatgg ttcgctctcc tatagattct gcctccccag gaggtgatta tccacttggg gacttgactc caaccactat ggaagaggct acctctgggg taacccccgg gactttgccg agtaccccag tcacctcgtt tcctgggatt cctgacaccc ttcctccagg ctctgcaccc ttagaagccc ccatgacccc agtaacagat gattcacccc agaaaaagat gcttggacag aaagcaactc cacccccctc ccctctgctg tcagagctct tgaagaaggg cagcctcctg cctactagcc ccagactggt caatgagagt gaaatggctg tggcttctgg ccacctgaac agtacaggtg tcctcctgga ggtaggcggg gtccttccca tgatacatgg tggggagata cagcaaacac ccaatactgt tgcagcctcc cctgctgcat caggtgctcc cactctttcc cggcttttag aagctggtcc tacacagttc accacacctc ttgcttcctt cactactgtt gccagtgagc ctccagttaa acttgtgcca ccccctgtag agtctgtgtc ccaagctacc attgtcatga tgcctgcgct gccagcacca tcctctgctc cggctgtctc cactactgaa agtgtagctc cagtgagtca acccgacaac tgtgttccca tggaggctgt gggggatcca catactgtga ctgtttccat ggacagcagt gaaatatcca tgatcatcaa ttctatcaaa gaagagtgtt ttcgatcagg ggtagcagag gctcctgttg gatcaaaggc tcccagcata gatgggaagg aagaattaga tctggctgag aagatggata ttgctgtgtc ttacacaggt gaagagctgg attttgagac tgttggagac atcattgcca tcattgagga caaggtagat gatcatcctg aagtgctgga tgtggcagca gtggaagcag cactgtcatt ttgtgaagaa aatgatgatc ctcagtccct gcctggcccc tgggagcatc ctatccagca ggagcgggac aagccagtac ctctccctgc accagaaatg acggtcaagc aagagagact ggactttgag gaaacggaaa acaagggaat acatgaactg gtggacatca gggagcccag tgcagagatc aaggtggaac ctgcagaacc agagccagtc atttcaggag ccgaaatagt agctggagtt gttccagcca caagtatgga gccaccagaa ctcaggagtc aggacttaga tgaggaactg ggaagtactg cagctggaga gattgttgaa gcagatgttg ccattgggaa aggcgatgag actccactta caaatgtgaa gacagaggca tcccctgaaa gcatgttgtc tccatcacat ggctcaaatc ccattgaaga tcctttagag gcagagactc agcacaagtt tgaaatgtca gactcattga aagaagaatc agggactatt tttggaagcc agataaagga tgccccaggt gaggatgagg aggaagatgg tgtcagtgaa gcggccagcc tagaggagcc taaggaagag gatcaaggag aaggctactt gtcagaaatg gataatgaac ctcctgtgag cgagagtgat gatggcttca gcatacacaa tgctacactg cagtcacaca cactggcaga ctccatcccc agcagccctg cttcttcaca gttctctgtc tgtagtgagg atcaggaagc tattcaggca cagaaaattt ggaagaaagc catcatgctt gtatggagag ctgcagctaa tcataggtat gccaatgtct tcctgcagcc tgttacagat gacatagcac ctggctacca cagcattgtg cagaggccta tggatttgtc aactattaag aaaaacatag aaaatggact gatccgaagc acagctgaat ttcagcgtga cattatgctg atgtttcaga atgctgtaat gtacaatagc tcagaccatg atgtctatca catggcagtg gagatgcagc gagatgtctt ggaacagatc cagcaattct tggccacgca gttgattatg caaacatccg agtctgggat cagtgctaaa agtcttcgag ggagagattc tacccgcaaa caggatgctt cagagaagga cagtgtccca atgggctctc ctgccttcct tctctctctc tttgatggag gaaccagggg acgccgctgt gccattgaag cagatatgaa gatgaaaaag tga. It is sometimes possible for the material contained within the vial of "BRD8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.