Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BOC cdna clone

BOC cDNA Clone

Gene Names
BOC; CDON2
Synonyms
BOC; BOC cDNA Clone; BOC cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcgtgggacgatgacggcgtggagaggaatgaggcctgaggtcacactggcttgcctcctcctagccacagcaggctgctttgctgacttgaacgaggtccctcaggtcaccgtccagcctgcgtccaccgtccagaagcccggaggcactgtgatcttgggctgcgtggtggaacctccaaggatgaatgtaacctggcgcctgaatggaaaggagctgaatggctcggatgatgctctgggtgtcctcatcacccacgggaccctcgtcatcactgcccttaacaaccacactgtgggacggtaccagtgtgtggcccggatgcctgcgggggctgtggccagcgtgccagccactgtgacactagccagtgagtctgctcctttgcctccctgccatggtgcggtccctcctcatctctcccaccctgaagcccccaccattcatgctgcctcttgttactcttag
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
121,188 Da
NCBI Official Full Name
Homo sapiens Boc homolog (mouse), mRNA
NCBI Official Synonym Full Names
BOC cell adhesion associated, oncogene regulated
NCBI Official Symbol
BOC
NCBI Official Synonym Symbols
CDON2
NCBI Protein Information
brother of CDO
UniProt Protein Name
Brother of CDO
Protein Family
UniProt Gene Name
BOC
UniProt Synonym Gene Names
Protein BOC
UniProt Entry Name
BOC_HUMAN

NCBI Description

The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]

Uniprot Description

BOC: Component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells. Promotes differentiation of myogenic cells. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Cell development/differentiation; Cell adhesion

Chromosomal Location of Human Ortholog: 3q13.2

Cellular Component: plasma membrane

Molecular Function: protein binding

Biological Process: positive regulation of muscle cell differentiation; positive regulation of myoblast differentiation

Research Articles on BOC

Similar Products

Product Notes

The BOC boc (Catalog #AAA1276533) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcgtg ggacgatgac ggcgtggaga ggaatgaggc ctgaggtcac actggcttgc ctcctcctag ccacagcagg ctgctttgct gacttgaacg aggtccctca ggtcaccgtc cagcctgcgt ccaccgtcca gaagcccgga ggcactgtga tcttgggctg cgtggtggaa cctccaagga tgaatgtaac ctggcgcctg aatggaaagg agctgaatgg ctcggatgat gctctgggtg tcctcatcac ccacgggacc ctcgtcatca ctgcccttaa caaccacact gtgggacggt accagtgtgt ggcccggatg cctgcggggg ctgtggccag cgtgccagcc actgtgacac tagccagtga gtctgctcct ttgcctccct gccatggtgc ggtccctcct catctctccc accctgaagc ccccaccatt catgctgcct cttgttactc ttag. It is sometimes possible for the material contained within the vial of "BOC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.