Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BNIP2 cdna clone

BNIP2 cDNA Clone

Gene Names
BNIP2; NIP2; BNIP-2
Synonyms
BNIP2; BNIP2 cDNA Clone; BNIP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaggtgtggaacttaaagaagaatggcaagatgaagattttccgatacctttaccagaagatgatagtattgaagcagatatactagctataactggaccagaggaccagcctggctcactagaagttaatggaaataaagtgagaaagaaactaatggctccagacattagcctgacactggatcctagtgatggctctgtattgtcagatgatttggatgaaagtggggagattgacttagatggcttagacacaccgtcagagaatagtaatgagtttgagtgggaagatgatcttccaaaacccaagactactgaagtaattaggaaaggctcaattactgaatacacagcagcagaggaaaaagaagatggacgacgctggcgtatgttcaggattggagaacaggaccacagggttgatatgaaggcaattgaaccctataaaaaagttatcagccatgggggatattatggggatggattaaatgccattgttgtgtttgctgtctgtttcatgcctgaaagtagtcagcctaactatagatacctgatggacaatctttttaaatatgttattggcactttggagctattagtagcagaaaactacatgatagtttatttaaatggtgcaacaactcgaagaaaaatgcccagtctgggatggctcaggaaatgttatcagcaaattgatagaaggttacggaaaaatctaaaatccctaatcattgtacatccttcttggtttatcagaacacttctggctgttacaagaccatttattagctcgaaattcagccaaaaaattagatacgtgtttaatttggcagaactagcagaacttgtccccatggaatacgttggcataccagaatgcataaaacaagttgatcaagaacttaatggaaaacaagatgaaccgaaaaatgaacagtaa
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
663
Molecular Weight
43,135 Da
NCBI Official Full Name
Homo sapiens BCL2/adenovirus E1B 19kDa interacting protein 2, mRNA
NCBI Official Synonym Full Names
BCL2 interacting protein 2
NCBI Official Symbol
BNIP2
NCBI Official Synonym Symbols
NIP2; BNIP-2
NCBI Protein Information
BCL2/adenovirus E1B 19 kDa protein-interacting protein 2
UniProt Protein Name
BCL2/adenovirus E1B 19 kDa protein-interacting protein 2
UniProt Gene Name
BNIP2
UniProt Synonym Gene Names
NIP2
UniProt Entry Name
BNIP2_HUMAN

NCBI Description

This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

BNIP2: Implicated in the suppression of cell death. Interacts with the BCL-2 and adenovirus E1B 19 kDa proteins. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Apoptosis

Chromosomal Location of Human Ortholog: 15q22.2

Cellular Component: cytoplasm; cytosol; intracellular membrane-bound organelle; nuclear envelope

Molecular Function: calcium ion binding; GTPase activator activity; identical protein binding; protein binding

Biological Process: apoptosis; negative regulation of apoptosis; positive regulation of muscle cell differentiation

Research Articles on BNIP2

Similar Products

Product Notes

The BNIP2 bnip2 (Catalog #AAA1275829) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaggtg tggaacttaa agaagaatgg caagatgaag attttccgat acctttacca gaagatgata gtattgaagc agatatacta gctataactg gaccagagga ccagcctggc tcactagaag ttaatggaaa taaagtgaga aagaaactaa tggctccaga cattagcctg acactggatc ctagtgatgg ctctgtattg tcagatgatt tggatgaaag tggggagatt gacttagatg gcttagacac accgtcagag aatagtaatg agtttgagtg ggaagatgat cttccaaaac ccaagactac tgaagtaatt aggaaaggct caattactga atacacagca gcagaggaaa aagaagatgg acgacgctgg cgtatgttca ggattggaga acaggaccac agggttgata tgaaggcaat tgaaccctat aaaaaagtta tcagccatgg gggatattat ggggatggat taaatgccat tgttgtgttt gctgtctgtt tcatgcctga aagtagtcag cctaactata gatacctgat ggacaatctt tttaaatatg ttattggcac tttggagcta ttagtagcag aaaactacat gatagtttat ttaaatggtg caacaactcg aagaaaaatg cccagtctgg gatggctcag gaaatgttat cagcaaattg atagaaggtt acggaaaaat ctaaaatccc taatcattgt acatccttct tggtttatca gaacacttct ggctgttaca agaccattta ttagctcgaa attcagccaa aaaattagat acgtgtttaa tttggcagaa ctagcagaac ttgtccccat ggaatacgtt ggcataccag aatgcataaa acaagttgat caagaactta atggaaaaca agatgaaccg aaaaatgaac agtaa. It is sometimes possible for the material contained within the vial of "BNIP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.