Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BNIP1 cdna clone

BNIP1 cDNA Clone

Gene Names
BNIP1; NIP1; SEC20; TRG-8
Synonyms
BNIP1; BNIP1 cDNA Clone; BNIP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctccccaagacgtccacgtccggatctgtaaccaagagattgtcaaatttgacctggaggtgaaggcgcttattcaggatatccgtgattgttcaggacccttaagtgctcttactgaactgaatactaaagtaaaagagaaatttcaacagttgcgtcacagaatacaggacctggagcagttggctaaagagcaagacaaagaatcagagaaacaacttctactccaggaagtggagaatcacaaaaagcagatgctcagcaatcaggcctcatggaggaaagctaatctcacctgcaaaattgcaatcgacaatctagagaaagcagaacttcttcagggaggagatctcttaaggcaaaggaaaaccaccaaagagagcctggcccagacatccagtaccatcactgagagcctcatggggatcagcaggatgatggcccagcaggtccagcagagcgaggaggccatgcagtctctagtcacttcttcacgaacgatcctggatgcaaatgaagaatttaagtccatgtcgggcaccatccagctgggccggaagcttatcacaaaatacaatcgccgggagctgacggacaagcttctcatcttccttgcgctagccctgtttcttgctacggtcctctatattgtgaaaaagcggctctttccatttttgtga
Sequence Length
687
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
662
Molecular Weight
27,333 Da
NCBI Official Full Name
Homo sapiens BCL2/adenovirus E1B 19kDa interacting protein 1, mRNA
NCBI Official Synonym Full Names
BCL2 interacting protein 1
NCBI Official Symbol
BNIP1
NCBI Official Synonym Symbols
NIP1; SEC20; TRG-8
NCBI Protein Information
vesicle transport protein SEC20
UniProt Protein Name
Vesicle transport protein SEC20
Protein Family
UniProt Gene Name
BNIP1
UniProt Synonym Gene Names
NIP1; SEC20L; TRG-8
UniProt Entry Name
SEC20_HUMAN

NCBI Description

This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011]

Uniprot Description

BNIP1: SNARE that may be involved in targeting and fusion of Golgi-derived retrograde transport vesicles with the ER. Required for maintenance of ER network. Implicated in the suppression of cell death. May be involved in mitochondrial autophagy. Belongs to the SEC20 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Apoptosis

Chromosomal Location of Human Ortholog: 5q33-q34

Cellular Component: cytoplasm; endoplasmic reticulum; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; intracellular membrane-bound organelle; nuclear envelope; SNARE complex

Molecular Function: protein binding; SNAP receptor activity

Biological Process: apoptosis; endoplasmic reticulum membrane fusion; endoplasmic reticulum organization and biogenesis; negative regulation of apoptosis; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on BNIP1

Similar Products

Product Notes

The BNIP1 bnip1 (Catalog #AAA1265933) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctc cccaagacgt ccacgtccgg atctgtaacc aagagattgt caaatttgac ctggaggtga aggcgcttat tcaggatatc cgtgattgtt caggaccctt aagtgctctt actgaactga atactaaagt aaaagagaaa tttcaacagt tgcgtcacag aatacaggac ctggagcagt tggctaaaga gcaagacaaa gaatcagaga aacaacttct actccaggaa gtggagaatc acaaaaagca gatgctcagc aatcaggcct catggaggaa agctaatctc acctgcaaaa ttgcaatcga caatctagag aaagcagaac ttcttcaggg aggagatctc ttaaggcaaa ggaaaaccac caaagagagc ctggcccaga catccagtac catcactgag agcctcatgg ggatcagcag gatgatggcc cagcaggtcc agcagagcga ggaggccatg cagtctctag tcacttcttc acgaacgatc ctggatgcaa atgaagaatt taagtccatg tcgggcacca tccagctggg ccggaagctt atcacaaaat acaatcgccg ggagctgacg gacaagcttc tcatcttcct tgcgctagcc ctgtttcttg ctacggtcct ctatattgtg aaaaagcggc tctttccatt tttgtga. It is sometimes possible for the material contained within the vial of "BNIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.