Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BMP4 cdna clone

BMP4 cDNA Clone

Gene Names
BMP4; ZYME; BMP2B; OFC11; BMP2B1; MCOPS6
Synonyms
BMP4; BMP4 cDNA Clone; BMP4 cdna clone
Ordering
For Research Use Only!
Sequence
atgattcctggtaaccgaatgctgatggtcgttttattatgccaagtcctgctaggaggcgcgagccatgctagtttgatacctgagacggggaagaaaaaagtcgccgagattcagggccacgcgggaggacgccgctcagggcagagccatgagctcctgcgggacttcgaggcgacacttctgcagatgtttgggctgcgccgccgcccgcagcctagcaagagtgccgtcattccggactacatgcgggatctttaccggcttcagtctggggaggaggaggaagagcagatccacagcactggtcttgagtatcctgagcgcccggccagccgggccaacaccgtgaggagcttccaccacgaagaacatctggagaacatcccagggaccagtgaaaactctgcttttcgtttcctctttaacctcagcagcatccctgagaacgaggcgatctcctctgcagagcttcggctcttccgggagcaggtggaccagggccctgattgggaaaggggcttccaccgtataaacatttatgaggttatgaagcccccagcagaagtggtgcctgggcacctcatcacacgactactggacacgagactggtccaccacaatgtgacacggtgggaaacttttgatgtgagccctgcggtccttcgctggacccgggagaagcagccaaactatgggctagccattgaggtgactcacctccatcagactcggacccaccagggccagcatgtcaggattagccgatcgttacctcaagggagtgggaattgggcccagctccggcccctcctggtcacctttggccatgatggccggggccatgccttgacccgacgccggagggccaagcgtagccctaagcatcactcacagcgggccaggaagaagaataagaactgccggcgccactcgctctatgtggacttcagcgatgtgggctggaatgactggattgtggccccaccaggctaccaggccttctactgccatggggactgcccctttccactggctgaccacctcaactcaaccaaccatgccattgtgcagaccctggtcaattctgtcaattccagtatccccaaagcctgttgtgtgcccactgaactgagtgccatctccatgctgtacctggatgagtatgataaggtggtactgaaaaattatcaggagatggtagtagagggatgtgggtgccgctga
Sequence Length
1227
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
652
Molecular Weight
46,555 Da
NCBI Official Full Name
Homo sapiens bone morphogenetic protein 4, mRNA
NCBI Official Synonym Full Names
bone morphogenetic protein 4
NCBI Official Symbol
BMP4
NCBI Official Synonym Symbols
ZYME; BMP2B; OFC11; BMP2B1; MCOPS6
NCBI Protein Information
bone morphogenetic protein 4
UniProt Protein Name
Bone morphogenetic protein 4
UniProt Gene Name
BMP4
UniProt Synonym Gene Names
BMP2B; DVR4; BMP-4; BMP-2B
UniProt Entry Name
BMP4_HUMAN

NCBI Description

This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]

Uniprot Description

BMP4: Induces cartilage and bone formation. Also act in mesoderm induction, tooth development, limb formation and fracture repair. Acts in concert with PTHLH/PTHRP to stimulate ductal outgrowth during embryonic mammary development and to inhibit hair follicle induction. Homodimer; disulfide-linked. Interacts with GREM2. Part of a complex consisting of TWSG1 and CHRD. Interacts with the serine proteases, HTRA1 and HTRA3; the interaction with either inhibits BMP4-mediated signaling. The HTRA protease activity is required for this inhibition. Interacts with SOSTDC1. Expressed in the lung and lower levels seen in the kidney. Present also in normal and neoplastic prostate tissues, and prostate cancer cell lines. Belongs to the TGF-beta family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q22-q23

Cellular Component: extracellular region; extracellular space

Molecular Function: chemoattractant activity; cytokine activity; protein binding; transforming growth factor beta receptor binding

Biological Process: activation of MAPKK activity; alveolus development; blood vessel endothelial cell proliferation during sprouting angiogenesis; BMP signaling pathway; branching morphogenesis of a tube; chondrocyte differentiation; common-partner SMAD protein phosphorylation; endochondral ossification; hemopoietic progenitor cell differentiation; intermediate mesodermal cell differentiation; kidney development; lymphoid progenitor cell differentiation; macrophage differentiation; mesonephros development; monocyte differentiation; negative regulation of apoptosis; negative regulation of cell cycle; negative regulation of cell proliferation; negative regulation of immature T cell proliferation in the thymus; negative regulation of MAP kinase activity; negative regulation of mitosis; negative regulation of myoblast differentiation; negative regulation of phosphorylation; negative regulation of striated muscle development; negative regulation of T cell differentiation in the thymus; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; odontogenesis; osteoblast differentiation; positive regulation of apoptosis; positive regulation of BMP signaling pathway; positive regulation of bone mineralization; positive regulation of cardiac muscle fiber development; positive regulation of collagen biosynthetic process; positive regulation of endothelial cell proliferation; positive regulation of epidermal cell differentiation; positive regulation of epithelial cell proliferation; positive regulation of ossification; positive regulation of osteoblast differentiation; positive regulation of protein amino acid phosphorylation; positive regulation of protein binding; positive regulation of smooth muscle cell proliferation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; post-embryonic development; regulation of cell fate commitment; regulation of protein import into nucleus; smooth muscle development; smoothened signaling pathway; steroid hormone mediated signaling; telencephalon development; ureteric bud branching; ureteric bud development

Disease: Microphthalmia, Syndromic 6; Orofacial Cleft 11

Research Articles on BMP4

Similar Products

Product Notes

The BMP4 bmp4 (Catalog #AAA1272730) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcctg gtaaccgaat gctgatggtc gttttattat gccaagtcct gctaggaggc gcgagccatg ctagtttgat acctgagacg gggaagaaaa aagtcgccga gattcagggc cacgcgggag gacgccgctc agggcagagc catgagctcc tgcgggactt cgaggcgaca cttctgcaga tgtttgggct gcgccgccgc ccgcagccta gcaagagtgc cgtcattccg gactacatgc gggatcttta ccggcttcag tctggggagg aggaggaaga gcagatccac agcactggtc ttgagtatcc tgagcgcccg gccagccggg ccaacaccgt gaggagcttc caccacgaag aacatctgga gaacatccca gggaccagtg aaaactctgc ttttcgtttc ctctttaacc tcagcagcat ccctgagaac gaggcgatct cctctgcaga gcttcggctc ttccgggagc aggtggacca gggccctgat tgggaaaggg gcttccaccg tataaacatt tatgaggtta tgaagccccc agcagaagtg gtgcctgggc acctcatcac acgactactg gacacgagac tggtccacca caatgtgaca cggtgggaaa cttttgatgt gagccctgcg gtccttcgct ggacccggga gaagcagcca aactatgggc tagccattga ggtgactcac ctccatcaga ctcggaccca ccagggccag catgtcagga ttagccgatc gttacctcaa gggagtggga attgggccca gctccggccc ctcctggtca cctttggcca tgatggccgg ggccatgcct tgacccgacg ccggagggcc aagcgtagcc ctaagcatca ctcacagcgg gccaggaaga agaataagaa ctgccggcgc cactcgctct atgtggactt cagcgatgtg ggctggaatg actggattgt ggccccacca ggctaccagg ccttctactg ccatggggac tgcccctttc cactggctga ccacctcaac tcaaccaacc atgccattgt gcagaccctg gtcaattctg tcaattccag tatccccaaa gcctgttgtg tgcccactga actgagtgcc atctccatgc tgtacctgga tgagtatgat aaggtggtac tgaaaaatta tcaggagatg gtagtagagg gatgtgggtg ccgctga. It is sometimes possible for the material contained within the vial of "BMP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.