Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

BMI1 cdna clone

BMI1 cDNA Clone

Gene Names
BMI1; PCGF4; RNF51; FLVI2/BMI1; flvi-2/bmi-1
Synonyms
BMI1; BMI1 cDNA Clone; BMI1 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgcatcgaacaacgagaatcaagatcactgagctaaatccccacctgatgtgtgtgctttgtggagggtacttcattgatgccacaaccataatagaatgtctacattccttctgtaaaacgtgtattgttcgttacctggagaccagcaagtattgtcctatttgtgatgtccaagttcacaagaccagaccactactgaatataaggtcagataaaactctccaagatattgtatacaaattagttccagggcttttcaaaaatgaaatgaagagaagaagggatttttatgcagctcatccttctgctgatgctgccaatggctctaatgaagatagaggagaggttgcagatgaagataagagaattataactgatgatgagataataagcttatccattgaattctttgaccagaacagattggatcggaaagtaaacaaagacaaagagaaatctaaggaggaggtgaatgataaaagatacttacgatgcccagcagcaatgactgtgatgcacttaagaaagtttctcagaagtaaaatggacatacctaatactttccagattgatgtcatgtatgaggaggaacctttaaaggattattatacactaatggatattgcctacatttatacctggagaaggaatggtccacttccattgaaatacagagttcgacctacttgtaaaagaatgaagatcagtcaccagagagatggactgacaaatgctggagaactggaaagtgactctgggagtgacaaggccaacagcccagcaggaggtattccctccacctcttcttgtttgcctagccccagtactccagtgcagtctcctcatccacagtttcctcacatttccagtactatgaatggaaccagcaacagccccagcggtaaccaccaatcttcttttgccaatagacctcgaaaatcatcagtaaatgggtcatcagcaacttcttctggttga
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
648
Molecular Weight
36,949 Da
NCBI Official Full Name
Homo sapiens BMI1 polycomb ring finger oncogene, mRNA
NCBI Official Synonym Full Names
BMI1 proto-oncogene, polycomb ring finger
NCBI Official Symbol
BMI1
NCBI Official Synonym Symbols
PCGF4; RNF51; FLVI2/BMI1; flvi-2/bmi-1
NCBI Protein Information
polycomb complex protein BMI-1
UniProt Protein Name
Polycomb complex protein BMI-1
Protein Family
UniProt Gene Name
BMI1
UniProt Synonym Gene Names
PCGF4; RNF51
UniProt Entry Name
BMI1_HUMAN

NCBI Description

This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene. [provided by RefSeq, Sep 2015]

Uniprot Description

BMI1: Component of a Polycomb group (PcG) multiprotein PRC1- like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. In the PRC1 complex, it is required to stimulate the E3 ubiquitin-protein ligase activity of RNF2/RING2. Component of a PRC1-like complex. Interacts with RING1 and RING2. Interacts vwith CBX7 and CBX8. Interacts with SPOP. Part of a complex consisting of BMI1, CUL3 and SPOP. Interacts with E4F1.

Protein type: EC 6.3.2.-; Motility/polarity/chemotaxis; Ubiquitin ligase; Ligase; Oncoprotein; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 10p11.23

Cellular Component: nucleoplasm; nucleus; PcG protein complex; ubiquitin ligase complex

Molecular Function: protein binding; zinc ion binding

Biological Process: hemopoiesis; negative regulation of gene expression, epigenetic; negative regulation of transcription from RNA polymerase II promoter; positive regulation of fibroblast proliferation; positive regulation of ubiquitin-protein ligase activity; protein sumoylation; regulation of gene expression; segment specification

Research Articles on BMI1

Similar Products

Product Notes

The BMI1 bmi1 (Catalog #AAA1273375) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcgaa caacgagaat caagatcact gagctaaatc cccacctgat gtgtgtgctt tgtggagggt acttcattga tgccacaacc ataatagaat gtctacattc cttctgtaaa acgtgtattg ttcgttacct ggagaccagc aagtattgtc ctatttgtga tgtccaagtt cacaagacca gaccactact gaatataagg tcagataaaa ctctccaaga tattgtatac aaattagttc cagggctttt caaaaatgaa atgaagagaa gaagggattt ttatgcagct catccttctg ctgatgctgc caatggctct aatgaagata gaggagaggt tgcagatgaa gataagagaa ttataactga tgatgagata ataagcttat ccattgaatt ctttgaccag aacagattgg atcggaaagt aaacaaagac aaagagaaat ctaaggagga ggtgaatgat aaaagatact tacgatgccc agcagcaatg actgtgatgc acttaagaaa gtttctcaga agtaaaatgg acatacctaa tactttccag attgatgtca tgtatgagga ggaaccttta aaggattatt atacactaat ggatattgcc tacatttata cctggagaag gaatggtcca cttccattga aatacagagt tcgacctact tgtaaaagaa tgaagatcag tcaccagaga gatggactga caaatgctgg agaactggaa agtgactctg ggagtgacaa ggccaacagc ccagcaggag gtattccctc cacctcttct tgtttgccta gccccagtac tccagtgcag tctcctcatc cacagtttcc tcacatttcc agtactatga atggaaccag caacagcccc agcggtaacc accaatcttc ttttgccaat agacctcgaa aatcatcagt aaatgggtca tcagcaactt cttctggttg a. It is sometimes possible for the material contained within the vial of "BMI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual