Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BLMH cdna clone

BLMH cDNA Clone

Gene Names
BLMH; BH; BMH
Synonyms
BLMH; BLMH cDNA Clone; BLMH cdna clone
Ordering
For Research Use Only!
Sequence
atgagcagctcgggactgaattcggagaaggtagctgctctgatacagaaactgaattccgacccccagttcgtacttgcccagaatgtcgggaccacccacgacctgctggacatctgtctgaagcgggccacggtgcagcgcgcgcagcatgtgttccagcacgccgtgccccaggagggcaagccaatcaccaaccagaagagctcagggcgatgctggatcttttcttgtctgaatgttatgaggcttccattcatgaaaaagttaaatattgaagaatttgagtttagccaatcttacctgtttttttgggacaaggttgaacgctgttatttcttcttgagtgcttttgtggacacagcccagagaaaggagcctgaggatgggaggctggtgcagtttttgcttatgaaccctgcaaatgatggtggccaatgggatatgcttgttaatattgttgaaaaatatggtgttatccctaagaaatgcttccctgaatcttatacaacagaggcaaccagaaggatgaatgatattctgaatcacaagatgagagaattctgtatacgactgcggaacctggtacacagtggagcaaccaaaggagaaatctcggccacacaggacgtcatgatggaggagatattccgagtggtgtgcatctgtttgggtaatccaccagagacattcacctgggaatatcgagacaaagataaaaattatcagaaaattggccccataacacccttggagttttacagggaacatgtcaagccactcttcaatatggaagataagatttgtttagtgaatgaccctaggccccagcacaagtacaacaaactttacacagtggaatacttaagcaatatggttggagggagaaaaactctatacaacaaccagcccattgacttcctgaaaaagatggttgctgcctccatcaaagatggagaggctgtgtggtttggctgtgatgttggaaaacacttcaatagcaagctgggcctcagtgacatgaatctctatgaccatgagttagtgtttggtgtctccttgaagaacatgaataaagcggagaggctgacttttggtgagtcacttatgacccacgccatgaccttcactgctgtctcagagaaggatgatcaggatggtgctttcacaaaatggagagtggagaattcatggggtgaagaccatggccacaaaggttacctgtgcatgacagatgagtggttctctgagtatgtctacgaagtggtggtggacaggaagcatgtccctgaagaggtgctagctgtgttagagcaggaacccattatcctgccagcatgggaccccatgggagctttggctgagtga
Sequence Length
1368
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
642
Molecular Weight
52,562 Da
NCBI Official Full Name
Homo sapiens bleomycin hydrolase, mRNA
NCBI Official Synonym Full Names
bleomycin hydrolase
NCBI Official Symbol
BLMH
NCBI Official Synonym Symbols
BH; BMH
NCBI Protein Information
bleomycin hydrolase
UniProt Protein Name
Bleomycin hydrolase
Protein Family
UniProt Gene Name
BLMH
UniProt Synonym Gene Names
BH; BLM hydrolase; BMH
UniProt Entry Name
BLMH_HUMAN

NCBI Description

Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily. [provided by RefSeq, Jul 2008]

Uniprot Description

BLMH: The normal physiological role of BLM hydrolase is unknown, but it catalyzes the inactivation of the antitumor drug BLM (a glycopeptide) by hydrolyzing the carboxamide bond of its B- aminoalaninamide moiety thus protecting normal and malignant cells from BLM toxicity. Belongs to the peptidase C1 family.

Protein type: Protease; EC 3.4.22.40

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: aminopeptidase activity; carboxypeptidase activity; cysteine-type peptidase activity; protein binding

Biological Process: protein polyubiquitination

Disease: Alzheimer Disease

Research Articles on BLMH

Similar Products

Product Notes

The BLMH blmh (Catalog #AAA1278241) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcagct cgggactgaa ttcggagaag gtagctgctc tgatacagaa actgaattcc gacccccagt tcgtacttgc ccagaatgtc gggaccaccc acgacctgct ggacatctgt ctgaagcggg ccacggtgca gcgcgcgcag catgtgttcc agcacgccgt gccccaggag ggcaagccaa tcaccaacca gaagagctca gggcgatgct ggatcttttc ttgtctgaat gttatgaggc ttccattcat gaaaaagtta aatattgaag aatttgagtt tagccaatct tacctgtttt tttgggacaa ggttgaacgc tgttatttct tcttgagtgc ttttgtggac acagcccaga gaaaggagcc tgaggatggg aggctggtgc agtttttgct tatgaaccct gcaaatgatg gtggccaatg ggatatgctt gttaatattg ttgaaaaata tggtgttatc cctaagaaat gcttccctga atcttataca acagaggcaa ccagaaggat gaatgatatt ctgaatcaca agatgagaga attctgtata cgactgcgga acctggtaca cagtggagca accaaaggag aaatctcggc cacacaggac gtcatgatgg aggagatatt ccgagtggtg tgcatctgtt tgggtaatcc accagagaca ttcacctggg aatatcgaga caaagataaa aattatcaga aaattggccc cataacaccc ttggagtttt acagggaaca tgtcaagcca ctcttcaata tggaagataa gatttgttta gtgaatgacc ctaggcccca gcacaagtac aacaaacttt acacagtgga atacttaagc aatatggttg gagggagaaa aactctatac aacaaccagc ccattgactt cctgaaaaag atggttgctg cctccatcaa agatggagag gctgtgtggt ttggctgtga tgttggaaaa cacttcaata gcaagctggg cctcagtgac atgaatctct atgaccatga gttagtgttt ggtgtctcct tgaagaacat gaataaagcg gagaggctga cttttggtga gtcacttatg acccacgcca tgaccttcac tgctgtctca gagaaggatg atcaggatgg tgctttcaca aaatggagag tggagaattc atggggtgaa gaccatggcc acaaaggtta cctgtgcatg acagatgagt ggttctctga gtatgtctac gaagtggtgg tggacaggaa gcatgtccct gaagaggtgc tagctgtgtt agagcaggaa cccattatcc tgccagcatg ggaccccatg ggagctttgg ctgagtga. It is sometimes possible for the material contained within the vial of "BLMH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.