Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BIRC7 cdna clone

BIRC7 cDNA Clone

Gene Names
BIRC7; KIAP; LIVIN; MLIAP; RNF50; ML-IAP
Synonyms
BIRC7; BIRC7 cDNA Clone; BIRC7 cdna clone
Ordering
For Research Use Only!
Sequence
atgggacctaaagacagtgccaagtgcctgcaccgtggaccacagccgagccactgggcagccggtgatggtcccacgcaggagcgctgtggaccccgctctctgggcagccctgtcctaggcctggacacctgcagagcctgggaccacgtggatgggcagatcctgggccagctgcggcccctgacagaggaggaagaggaggagggcgccggggccaccttgtccagggggcctgccttccccggcatgggctctgaggagttgcgtctggcctccttctatgactggccgctgactgctgaggtgccacccgagctgctggctgctgccggcttcttccacacaggccatcaggacaaggtgaggtgcttcttctgctatgggggcctgcagagctggaagcgcggggacgacccctggacggagcatgccaagtggttccccagctgtcagttcctgctccggtcaaaaggaagagactttgtccacagtgtgcaggagactcactcccagctgctgggctcctgggacccgtgggaagaaccggaagacgcagcccctgtggccccctccgtccctgcctctgggtaccctgagctgcccacacccaggagagaggtccagtctgaaagtgcccaggagccaggaggggtcagtccagcccaggcccagagggcgtggtgggttcttgagcccccaggagccagggatgtggaggcgcagctgcggcggctgcaggaggagaggacgtgcaaggtgtgcctggaccgcgccgtgtccatcgtctttgtgccgtgcggccacctggtctgtgctgagtgtgcccccggcctgcagctgtgccccatctgcagagcccccgtccgcagccgcgtgcgcaccttcctgtcctag
Sequence Length
897
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,866 Da
NCBI Official Full Name
Homo sapiens baculoviral IAP repeat-containing 7, mRNA
NCBI Official Synonym Full Names
baculoviral IAP repeat containing 7
NCBI Official Symbol
BIRC7
NCBI Official Synonym Symbols
KIAP; LIVIN; MLIAP; RNF50; ML-IAP
NCBI Protein Information
baculoviral IAP repeat-containing protein 7
UniProt Protein Name
Baculoviral IAP repeat-containing protein 7
UniProt Gene Name
BIRC7
UniProt Synonym Gene Names
KIAP; LIVIN; MLIAP; RNF50; KIAP; ML-IAP; Truncated livin; p30-Livin; tLivin
UniProt Entry Name
BIRC7_HUMAN

NCBI Description

This gene encodes a member of the inhibitor of apoptosis protein (IAP) family, and contains a single copy of a baculovirus IAP repeat (BIR) as well as a RING-type zinc finger domain. The BIR domain is essential for inhibitory activity and interacts with caspases, while the RING finger domain sometimes enhances antiapoptotic activity but does not inhibit apoptosis alone. Elevated levels of the encoded protein may be associated with cancer progression and play a role in chemotherapy sensitivity. Alternative splicing results in multiple transcript variants [provided by RefSeq, Jul 2013]

Uniprot Description

BIRC7: Apoptotic regulator capable of exerting proapoptotic and anti-apoptotic activities and plays crucial roles in apoptosis, cell proliferation, and cell cycle control. Its anti-apoptotic activity is mediated through the inhibition of CASP3, CASP7 and CASP9, as well as by its E3 ubiquitin-protein ligase activity. As it is a weak caspase inhibitor, its anti-apoptotic activity is thought to be due to its ability to ubiquitinate DIABLO/SMAC targeting it for degradation thereby promoting cell survival. May contribute to caspase inhibition, by blocking the ability of DIABLO/SMAC to disrupt XIAP/BIRC4-caspase interactions. Protects against apoptosis induced by TNF or by chemical agents such as adriamycin, etoposide or staurosporine. Suppression of apoptosis is mediated by activation of MAPK8/JNK1, and possibly also of MAPK9/JNK2. This activation depends on TAB1 and NR2C2/TAK1. In vitro, inhibits CASP3 and proteolytic activation of pro-CASP9. Isoform 1 blocks staurosporine-induced apoptosis. Isoform 2 blocks etoposide-induced apoptosis. Isoform 2 protects against natural killer (NK) cell killing whereas isoform 1 augments killing. Binds to CASP9. Interaction with DIABLO/SMAC via the BIR domain disrupts binding to CASP9 and apoptotic suppressor activity. Interacts with TAB1. In vitro, interacts with CASP3 and CASP7 via its BIR domain. Isoform 1 and isoform 2 are expressed at very low levels or not detectable in most adult tissues. Detected in adult heart, placenta, lung, lymph node, spleen and ovary, and in several carcinoma cell lines. Isoform 2 is detected in fetal kidney, heart and spleen, and at lower levels in adult brain, skeletal muscle and peripheral blood leukocytes. Belongs to the IAP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Apoptosis; Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 20q13.3

Cellular Component: cytoplasm; Golgi apparatus; nucleus; spindle microtubule

Molecular Function: cysteine protease inhibitor activity; protein binding; ubiquitin-protein ligase activity

Biological Process: negative regulation of apoptosis; protein ubiquitination; regulation of cell proliferation; regulation of signal transduction

Research Articles on BIRC7

Similar Products

Product Notes

The BIRC7 birc7 (Catalog #AAA1265908) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaccta aagacagtgc caagtgcctg caccgtggac cacagccgag ccactgggca gccggtgatg gtcccacgca ggagcgctgt ggaccccgct ctctgggcag ccctgtccta ggcctggaca cctgcagagc ctgggaccac gtggatgggc agatcctggg ccagctgcgg cccctgacag aggaggaaga ggaggagggc gccggggcca ccttgtccag ggggcctgcc ttccccggca tgggctctga ggagttgcgt ctggcctcct tctatgactg gccgctgact gctgaggtgc cacccgagct gctggctgct gccggcttct tccacacagg ccatcaggac aaggtgaggt gcttcttctg ctatgggggc ctgcagagct ggaagcgcgg ggacgacccc tggacggagc atgccaagtg gttccccagc tgtcagttcc tgctccggtc aaaaggaaga gactttgtcc acagtgtgca ggagactcac tcccagctgc tgggctcctg ggacccgtgg gaagaaccgg aagacgcagc ccctgtggcc ccctccgtcc ctgcctctgg gtaccctgag ctgcccacac ccaggagaga ggtccagtct gaaagtgccc aggagccagg aggggtcagt ccagcccagg cccagagggc gtggtgggtt cttgagcccc caggagccag ggatgtggag gcgcagctgc ggcggctgca ggaggagagg acgtgcaagg tgtgcctgga ccgcgccgtg tccatcgtct ttgtgccgtg cggccacctg gtctgtgctg agtgtgcccc cggcctgcag ctgtgcccca tctgcagagc ccccgtccgc agccgcgtgc gcaccttcct gtcctag. It is sometimes possible for the material contained within the vial of "BIRC7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.