Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BIRC3 cdna clone

BIRC3 cDNA Clone

Gene Names
BIRC3; AIP1; API2; MIHC; CIAP2; HAIP1; HIAP1; MALT2; RNF49; c-IAP2
Synonyms
BIRC3; BIRC3 cDNA Clone; BIRC3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacatagtagaaaacagcatattcttatcaaatttgatgaaaagcgccaacacgtttgaactgaaatacgacttgtcatgtgaactgtaccgaatgtctacgtattccacttttcctgctggggttcctgtctcagaaaggagtcttgctcgtgctggtttctattacactggtgtgaatgacaaggtcaaatgcttctgttgtggcctgatgctggataactggaaaagaggagacagtcctactgaaaagcataaaaagttgtatcctagctgcagattcgttcagagtctaaattccgttaacaacttggaagctacctctcagcctacttttccttcttcagtaacaaattccacacactcattacttccgggtacagaaaacagtggatatttccgtggctcttattcaaactctccatcaaatcctgtaaactccagagcaaatcaagatttttctgccttgatgagaagttcctaccactgtgcaatgaataacgaaaatgccagattacttacttttcagacatggccattgacttttctgtcgccaacagatctggcaaaagcaggcttttactacataggacctggagacagagtggcttgctttgcctgtggtggaaaattgagcaattgggaaccgaaggataatgctatgtcagaacacctgagacattttcccaaatgcccatttatagaaaatcagcttcaagacacttcaagatacacagtttctaatctgagcatgcagacacatgcagcccgctttaaaacattctttaactggccctctagtgttctagttaatcctgagcagcttgcaagtgcgggtttttattatgtgggtaacagtgatgatgtcaaatgcttttgctgtgatggtggactcaggtgttgggaatctggagatgatccatgggttcaacatgccaagtggtttccaaggtgtgagtacttgataagaattaaaggacaggagttcatccgtcaagttcaagccagttaccctcatctacttgaacagctgctatccacatcagacagcccaggagatgaaaatgcagagtcatcaattatccattttgaacctggagaagaccattcagaagatgcaatcatgatgaatactcctgtgattaatgctgccgtggaaatgggctttagtagaagcctggtaaaacagacagttcagagaaaaatcctagcaactggagagaattatagactagtcaatgatcttgtgttagacttactcaatgcagaagatgaaataagggaagaggagagagaaagagcaactgaggaaaaagaatcaaatgatttattattaatccggaagaatagaatggcactttttcaacatttgacttgtgtaattccaatcctggatagtctactaactgccggaattattaatgaacaagaacatgatgttattaaacagaagacacagacgtctttacaagcaagagaactgattgatacgattttagtaaaaggaaatattgcagccactgtattcagaaactctctgcaagaagctgaagctgtgttatatgagcatttatttgtgcaacaggacataaaatatattcccacagaagatgtttcagatctaccagtggaagaacaattgcggagactacaagaagaaagaacatgtaaagtgtgtatggacaaagaagtgtccatagtgtttattccttgtggtcatctagtagtatgcaaagattgtgctccttctttaagaaagtgtcctatttgtaggagtacaatcaagggtacagttcgtacatttctttcatga
Sequence Length
1815
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
330
Molecular Weight
68,372 Da
NCBI Official Full Name
Homo sapiens baculoviral IAP repeat-containing 3, mRNA
NCBI Official Synonym Full Names
baculoviral IAP repeat containing 3
NCBI Official Symbol
BIRC3
NCBI Official Synonym Symbols
AIP1; API2; MIHC; CIAP2; HAIP1; HIAP1; MALT2; RNF49; c-IAP2
NCBI Protein Information
baculoviral IAP repeat-containing protein 3
UniProt Protein Name
Baculoviral IAP repeat-containing protein 3
UniProt Gene Name
BIRC3
UniProt Synonym Gene Names
API2; MIHC; RNF49; hIAP-1; hIAP1
UniProt Entry Name
BIRC3_HUMAN

NCBI Description

This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]

Uniprot Description

cIAP2: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin- protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin- protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF1, and BCL10. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase- independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. Interacts with DIABLO/SMAC and with PRSS25; these interactions inhibit apoptotic suppressor activity. The BIR motifs region interacts with TNF receptor associated factors 1 and 2 (TRAF1 and TRAF2) to form an heteromeric complex, which is then recruited to the tumor necrosis factor receptor 2 (TNFR2). Interacts with RIP1, RIP2, RIP3, RIP4 and USP19. Highly expressed in fetal lung, and kidney. In the adult, expression is mainly seen in lymphoid tissues, including spleen, thymus and peripheral blood lymphocytes. USP19 regulates the stability of BIRC3/c-IAP2 by preventing its ubiquitination. Belongs to the IAP family.

Protein type: Ligase; Ubiquitin conjugating system; Apoptosis; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 11q22

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; spindle microtubule

Molecular Function: caspase inhibitor activity; protein binding; transferase activity; ubiquitin-protein ligase activity

Biological Process: cell surface receptor linked signal transduction; I-kappaB kinase/NF-kappaB cascade; negative regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of protein ubiquitination; regulation of apoptosis; regulation of inflammatory response; regulation of innate immune response; regulation of toll-like receptor signaling pathway; tumor necrosis factor-mediated signaling pathway

Research Articles on BIRC3

Similar Products

Product Notes

The BIRC3 birc3 (Catalog #AAA1273811) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacatag tagaaaacag catattctta tcaaatttga tgaaaagcgc caacacgttt gaactgaaat acgacttgtc atgtgaactg taccgaatgt ctacgtattc cacttttcct gctggggttc ctgtctcaga aaggagtctt gctcgtgctg gtttctatta cactggtgtg aatgacaagg tcaaatgctt ctgttgtggc ctgatgctgg ataactggaa aagaggagac agtcctactg aaaagcataa aaagttgtat cctagctgca gattcgttca gagtctaaat tccgttaaca acttggaagc tacctctcag cctacttttc cttcttcagt aacaaattcc acacactcat tacttccggg tacagaaaac agtggatatt tccgtggctc ttattcaaac tctccatcaa atcctgtaaa ctccagagca aatcaagatt tttctgcctt gatgagaagt tcctaccact gtgcaatgaa taacgaaaat gccagattac ttacttttca gacatggcca ttgacttttc tgtcgccaac agatctggca aaagcaggct tttactacat aggacctgga gacagagtgg cttgctttgc ctgtggtgga aaattgagca attgggaacc gaaggataat gctatgtcag aacacctgag acattttccc aaatgcccat ttatagaaaa tcagcttcaa gacacttcaa gatacacagt ttctaatctg agcatgcaga cacatgcagc ccgctttaaa acattcttta actggccctc tagtgttcta gttaatcctg agcagcttgc aagtgcgggt ttttattatg tgggtaacag tgatgatgtc aaatgctttt gctgtgatgg tggactcagg tgttgggaat ctggagatga tccatgggtt caacatgcca agtggtttcc aaggtgtgag tacttgataa gaattaaagg acaggagttc atccgtcaag ttcaagccag ttaccctcat ctacttgaac agctgctatc cacatcagac agcccaggag atgaaaatgc agagtcatca attatccatt ttgaacctgg agaagaccat tcagaagatg caatcatgat gaatactcct gtgattaatg ctgccgtgga aatgggcttt agtagaagcc tggtaaaaca gacagttcag agaaaaatcc tagcaactgg agagaattat agactagtca atgatcttgt gttagactta ctcaatgcag aagatgaaat aagggaagag gagagagaaa gagcaactga ggaaaaagaa tcaaatgatt tattattaat ccggaagaat agaatggcac tttttcaaca tttgacttgt gtaattccaa tcctggatag tctactaact gccggaatta ttaatgaaca agaacatgat gttattaaac agaagacaca gacgtcttta caagcaagag aactgattga tacgatttta gtaaaaggaa atattgcagc cactgtattc agaaactctc tgcaagaagc tgaagctgtg ttatatgagc atttatttgt gcaacaggac ataaaatata ttcccacaga agatgtttca gatctaccag tggaagaaca attgcggaga ctacaagaag aaagaacatg taaagtgtgt atggacaaag aagtgtccat agtgtttatt ccttgtggtc atctagtagt atgcaaagat tgtgctcctt ctttaagaaa gtgtcctatt tgtaggagta caatcaaggg tacagttcgt acatttcttt catga. It is sometimes possible for the material contained within the vial of "BIRC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.