Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BFSP2 cdna clone

BFSP2 cDNA Clone

Gene Names
BFSP2; CP47; CP49; LIFL-L; CTRCT12; PHAKOSIN
Synonyms
BFSP2; BFSP2 cDNA Clone; BFSP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgagaggcgagtggtagtggacttgcccaccagtgccagctccagcatgcccctccagaggcgcagggcgtccttcagggggccacggtcatcatcctccctggagagccccccagcctccaggaccaatgccatgagtggccttgtccgagcacccggggtctatgtaggaacagcacccagtgggtgcataggtggcttgggtgcccgtgtgacccgccgggccctcggcatcagcagtgtcttccttcagggcctgcggagctcaggcctggccaccgtgccggctccaggtttggagagggaccatggtgctgttgaggacctagggggctgcctggtggaatatatggccaaagtgcacgcccttgagcaagtcagtcaggagctggaaacacaactgcggatgcacctggagagcaaagccacacgctcgggaaactggggtgccctacgggcttcctgggccagcagctgccagcaggtgggtgaggcagtcttggaaaatgcccggctcatgctgcagacagaaactatccaggccggagcagatgactttaaagagagatatgaaaatgagcagccatttcgaaaggcagcagaagaggaaattaactctctgtataaagtcattgatgaggctaatttgactaaaatggacctggagagtcaaatagaaagtctgaaagaagaacttggctctctatcaagaaactatgaagaggatgtgaagctgctgcacaaacagttggcagggtgtgagctggaacaaatggatgctcccattggcactggtctggacgacatccttgagacgatcagaattcagtgggagagagatgttgaaaagaaccgggtggaggcaggagccctgctccaagctaagcaacaggcggaggtggcccacatgtcccagacccaggaggagaagctggcagctgccctcagggtggagttacacaacacttcgtgccaagtccagagcctccaggctgagacagaatccttacgtgccctgaaacgaggcctggagaacaccttgcacgatgccaagcactggcatgacatggagctccagaacctgggcgctgtggtcggccggctggaggcggagctcagggaaatccgagcggaggcggagcagcagcaacaggagcgcgcgcatctgctggcccgcaagtgccagctgcagaaggacgtggcgtcctaccacgccctgctggacagggaggagagcggctga
Sequence Length
1248
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,880 Da
NCBI Official Full Name
Homo sapiens beaded filament structural protein 2, phakinin, mRNA
NCBI Official Synonym Full Names
beaded filament structural protein 2
NCBI Official Symbol
BFSP2
NCBI Official Synonym Symbols
CP47; CP49; LIFL-L; CTRCT12; PHAKOSIN
NCBI Protein Information
phakinin
UniProt Protein Name
Phakinin
Protein Family
UniProt Gene Name
BFSP2
UniProt Synonym Gene Names
CP47; CP49; LIFL-L
UniProt Entry Name
BFSP2_HUMAN

NCBI Description

More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]

Uniprot Description

BFSP2: Involved in stabilization of lens fiber cell cytoskeleton. Defects in BFSP2 are the cause of cataract autosomal dominant multiple types 1 (ADC-MT1). Cataract is an opacification of the crystalline lens of the eye that frequently results in visual impairment or blindness. Opacities vary in morphology, are often confined to a portion of the lens, and may be static or progressive. In general, the more posteriorly located and dense an opacity, the greater the impact on visual function. The opacities can be nuclear, sutural, stellate cortical, lamellar, cortical, nuclear embryonic, Y-sutural, punctate cortical, congenital or with juvenile- and adult-onset. Belongs to the intermediate filament family.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 3q22.1

Cellular Component: cytoplasm; plasma membrane

Molecular Function: protein binding; structural constituent of cytoskeleton

Disease: Cataract 12, Multiple Types

Research Articles on BFSP2

Similar Products

Product Notes

The BFSP2 bfsp2 (Catalog #AAA1276418) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaga ggcgagtggt agtggacttg cccaccagtg ccagctccag catgcccctc cagaggcgca gggcgtcctt cagggggcca cggtcatcat cctccctgga gagcccccca gcctccagga ccaatgccat gagtggcctt gtccgagcac ccggggtcta tgtaggaaca gcacccagtg ggtgcatagg tggcttgggt gcccgtgtga cccgccgggc cctcggcatc agcagtgtct tccttcaggg cctgcggagc tcaggcctgg ccaccgtgcc ggctccaggt ttggagaggg accatggtgc tgttgaggac ctagggggct gcctggtgga atatatggcc aaagtgcacg cccttgagca agtcagtcag gagctggaaa cacaactgcg gatgcacctg gagagcaaag ccacacgctc gggaaactgg ggtgccctac gggcttcctg ggccagcagc tgccagcagg tgggtgaggc agtcttggaa aatgcccggc tcatgctgca gacagaaact atccaggccg gagcagatga ctttaaagag agatatgaaa atgagcagcc atttcgaaag gcagcagaag aggaaattaa ctctctgtat aaagtcattg atgaggctaa tttgactaaa atggacctgg agagtcaaat agaaagtctg aaagaagaac ttggctctct atcaagaaac tatgaagagg atgtgaagct gctgcacaaa cagttggcag ggtgtgagct ggaacaaatg gatgctccca ttggcactgg tctggacgac atccttgaga cgatcagaat tcagtgggag agagatgttg aaaagaaccg ggtggaggca ggagccctgc tccaagctaa gcaacaggcg gaggtggccc acatgtccca gacccaggag gagaagctgg cagctgccct cagggtggag ttacacaaca cttcgtgcca agtccagagc ctccaggctg agacagaatc cttacgtgcc ctgaaacgag gcctggagaa caccttgcac gatgccaagc actggcatga catggagctc cagaacctgg gcgctgtggt cggccggctg gaggcggagc tcagggaaat ccgagcggag gcggagcagc agcaacagga gcgcgcgcat ctgctggccc gcaagtgcca gctgcagaag gacgtggcgt cctaccacgc cctgctggac agggaggaga gcggctga. It is sometimes possible for the material contained within the vial of "BFSP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.