Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BFSP1 cdna clone

BFSP1 cDNA Clone

Gene Names
BFSP1; CP94; CP115; LIFL-H; CTRCT33
Synonyms
BFSP1; BFSP1 cDNA Clone; BFSP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtatgaaaatgagtgcgaatgtcaactcctgctaaaagaaatgcttgaacggcttaacaaggaagctgatgaagccttgctgcataacctacgccttcagctggaagcccaatttctgcaagatgatatcagtgcggcaaaggacaggcacaagaagaatcttctggaagttcagacctatatcagcatcctgcagcagatcatccacaccactcctccagcatccattgtgacgagtgggatgagggaggagaagctcctgacggagcgggaggtggccgccctgcggagtcagctggaggagggccgggaggtgctctcccacctgcaggcgcagagagtggagctgcaggcacagacaacaactctggaacaagctattaaaagtgcccatgagtgttatgacgatgagattcagctttataacgagcagattgagacactgcgcaaggagattgaggagacagagcgggtcctggagaagtcttcttacgactgccggcagctggcggtcgcccagcaaaccctgaagaatgagctggaccggtatcatcgtatcatcgagattgaaggcaacaggctgacctctgccttcattgaaactcccattcccctgttcacccagagccatggagtctctctcagcactggatccggtgggaaagatcttaccagagctctgcaggatataacagcagcaaaaccaagacaaaaagccctccccaagaatgttccaaggagaaaagagattataacaaaagacaaaaccaacggagctctggaagatgcaccattaaaaggtttggaagacacaaagctggtacaggtggtacttaaagaggaaagtgaatctaagtttgaatcagaaagtaaagaagtaagtcccctgacacaagaaggggctccagaggatgtgccagatggagggcagataagcaaaggctttgggaaactatacaggaaggtcaaggagaaagtgagaagccccaaagagcctgagacccccactgagctctacaccaaagagcggcacgtgctggtcacaggggatgccaattacgtggaccctagattctatgtctcctccatcacagctaaaggtggggtggctgtttctgttgcggaagactctgtgctttatgacggccaggtggagccctctcctgagtcacccaagccccctttagagaatgggcaggtgggtctgcaggagaaagaagatggacaaccaattgaccagcagcctatagacaaggagattgagccagatggtgcagagctggaaggccctgaagagaaacgtgagggtgaggagcgggacgaagagtccaggagaccctgtgccatggtcacacccggtgcagaggaaccgtctatacctgagcctccaaagcctgcggctgatcaggatggagctgaggtgcttgggactaggagcagaagcctgccagaaaaaggccctcccaaggctttggcctataagacagtggaagtggtggaatctatcgagaagatttccacggagagcattcagacatatgaagaaaccgctgtgatcgtggagaccatgattggaaagacaaagtcagacaagaagaaatcaggagagaagagctcttaa
Sequence Length
1623
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
631
Molecular Weight
58,569 Da
NCBI Official Full Name
Homo sapiens beaded filament structural protein 1, filensin, mRNA
NCBI Official Synonym Full Names
beaded filament structural protein 1
NCBI Official Symbol
BFSP1
NCBI Official Synonym Symbols
CP94; CP115; LIFL-H; CTRCT33
NCBI Protein Information
filensin
UniProt Protein Name
Filensin
Protein Family
UniProt Gene Name
BFSP1
UniProt Synonym Gene Names
CP115; LIFL-H
UniProt Entry Name
BFSP1_HUMAN

NCBI Description

This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Uniprot Description

BFSP1: Defects in BFSP1 are the cause of cataract cortical juvenile-onset (CCJO). A juvenile-onset cataract with opacities restricted to the cortex of the lens, not involving the nucleus. Belongs to the intermediate filament family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 20p12.1

Cellular Component: actin cytoskeleton; cytoplasm; mitochondrion; plasma membrane

Molecular Function: protein binding; structural constituent of cytoskeleton

Disease: Cataract 33

Research Articles on BFSP1

Similar Products

Product Notes

The BFSP1 bfsp1 (Catalog #AAA1270309) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatgaaa atgagtgcga atgtcaactc ctgctaaaag aaatgcttga acggcttaac aaggaagctg atgaagcctt gctgcataac ctacgccttc agctggaagc ccaatttctg caagatgata tcagtgcggc aaaggacagg cacaagaaga atcttctgga agttcagacc tatatcagca tcctgcagca gatcatccac accactcctc cagcatccat tgtgacgagt gggatgaggg aggagaagct cctgacggag cgggaggtgg ccgccctgcg gagtcagctg gaggagggcc gggaggtgct ctcccacctg caggcgcaga gagtggagct gcaggcacag acaacaactc tggaacaagc tattaaaagt gcccatgagt gttatgacga tgagattcag ctttataacg agcagattga gacactgcgc aaggagattg aggagacaga gcgggtcctg gagaagtctt cttacgactg ccggcagctg gcggtcgccc agcaaaccct gaagaatgag ctggaccggt atcatcgtat catcgagatt gaaggcaaca ggctgacctc tgccttcatt gaaactccca ttcccctgtt cacccagagc catggagtct ctctcagcac tggatccggt gggaaagatc ttaccagagc tctgcaggat ataacagcag caaaaccaag acaaaaagcc ctccccaaga atgttccaag gagaaaagag attataacaa aagacaaaac caacggagct ctggaagatg caccattaaa aggtttggaa gacacaaagc tggtacaggt ggtacttaaa gaggaaagtg aatctaagtt tgaatcagaa agtaaagaag taagtcccct gacacaagaa ggggctccag aggatgtgcc agatggaggg cagataagca aaggctttgg gaaactatac aggaaggtca aggagaaagt gagaagcccc aaagagcctg agacccccac tgagctctac accaaagagc ggcacgtgct ggtcacaggg gatgccaatt acgtggaccc tagattctat gtctcctcca tcacagctaa aggtggggtg gctgtttctg ttgcggaaga ctctgtgctt tatgacggcc aggtggagcc ctctcctgag tcacccaagc cccctttaga gaatgggcag gtgggtctgc aggagaaaga agatggacaa ccaattgacc agcagcctat agacaaggag attgagccag atggtgcaga gctggaaggc cctgaagaga aacgtgaggg tgaggagcgg gacgaagagt ccaggagacc ctgtgccatg gtcacacccg gtgcagagga accgtctata cctgagcctc caaagcctgc ggctgatcag gatggagctg aggtgcttgg gactaggagc agaagcctgc cagaaaaagg ccctcccaag gctttggcct ataagacagt ggaagtggtg gaatctatcg agaagatttc cacggagagc attcagacat atgaagaaac cgctgtgatc gtggagacca tgattggaaa gacaaagtca gacaagaaga aatcaggaga gaagagctct taa. It is sometimes possible for the material contained within the vial of "BFSP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.