BCL7C cdna clone
BCL7C cDNA Clone
Synonyms
BCL7C; BCL7C cDNA Clone; BCL7C cdna clone
Sequence
atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcgaaggcgggcaggtggcggggcagagagatcccgtggccgggaacgtcggggcaggggcgccagtccccgagggggtggccctctcatcctgctggatcttaatgatgagaacagcaaccagagtttccattcggaaggttccctgcaaaagggcacagagcccagtcctgggggcaccccccagcccagccgccctgtgtcacctgccggacccccagaaggggtccctgaggaggctcagcccccacggctgggccaagagagagatcccgggggcataactgctggcagcaccgacgaacccccaatgctgaccaaggaggagcctgttccagaactgctggaagctgaggcccccgaagcttaccctgtctttgagccagtgccacctgtccctgaggcagcccagggtgacacagaggactcggagggtgcccccccactcaagcgcatctgcccaaatgcccctgacccctga
Sequence Length
654
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,422 Da
NCBI Official Full Name
Homo sapiens B-cell CLL/lymphoma 7C, mRNA
NCBI Official Synonym Full Names
BCL tumor suppressor 7C
NCBI Official Symbol
BCL7C
NCBI Protein Information
B-cell CLL/lymphoma 7 protein family member C
UniProt Protein Name
B-cell CLL/lymphoma 7 protein family member C
Protein Family
UniProt Gene Name
BCL7C
UniProt Entry Name
BCL7C_HUMAN
NCBI Description
This gene is identified by the similarity of its product to the N-terminal region of BCL7A protein. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. The function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Uniprot Description
Bcl-7C: May play an anti-apoptotic role. Belongs to the BCL7 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 16p11
Research Articles on BCL7C
Similar Products
Product Notes
The BCL7C bcl7c (Catalog #AAA1277425) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggcc ggactgtacg ggccgagacc cggagccggg ccaaggatga catcaagaag gtgatggcga ccatcgagaa ggtccggaga tgggagaagc gatgggtgac tgtgggcgac acttcccttc gtatcttcaa gtgggtgcca gtggtggatc cccaggagga ggagcgaagg cgggcaggtg gcggggcaga gagatcccgt ggccgggaac gtcggggcag gggcgccagt ccccgagggg gtggccctct catcctgctg gatcttaatg atgagaacag caaccagagt ttccattcgg aaggttccct gcaaaagggc acagagccca gtcctggggg caccccccag cccagccgcc ctgtgtcacc tgccggaccc ccagaagggg tccctgagga ggctcagccc ccacggctgg gccaagagag agatcccggg ggcataactg ctggcagcac cgacgaaccc ccaatgctga ccaaggagga gcctgttcca gaactgctgg aagctgaggc ccccgaagct taccctgtct ttgagccagt gccacctgtc cctgaggcag cccagggtga cacagaggac tcggagggtg cccccccact caagcgcatc tgcccaaatg cccctgaccc ctga. It is sometimes possible for the material contained within the vial of "BCL7C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
