Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCL2L12 cdna clone

BCL2L12 cDNA Clone

Synonyms
BCL2L12; BCL2L12 cDNA Clone; BCL2L12 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggctctgaagagctggggctccgggaagacacgctgagggtcctagctgccttccttaggcgtggtgaggctgccgggtctcctgttccaactccacctagaagccctgcccaagaagagccaacagacttcctgagccgccttcgaagatgtcttccctgctccctggggcgaggagcagccccctctgagtcccctcggccttgctctctgcccatccgcccctgctatggtttagagcctggcccagctactccagacttctatgctttggtggcccagcggctggaacagctggtccaagagcagctgaaatctccgcccagcccagaattacagggtcccccatcgacagagaaggaagccatactgcggaggctggtggccctgctggaggaggaggcagaagtcattaaccagaagctggcctcggaccccgccctgcgcagcaagctggtccgcctgtcctccgactctttcgcccgcctggtggagctgttctgtagccgggatgacagctctcgcccaagccgagcatgccccgggccctcgcctccttccccggagcccctggcccgcctggccctagccatggagctgagccggcgcgtggccgggctggggggcaccctggccggactcagcgtggagcacgtgcacagcttcacgccctggatccaggcccacgggggctgggagggcatcctggctgtttcacccgtggacttgaacttgccattggactga
Sequence Length
753
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,665 Da
NCBI Official Full Name
Homo sapiens BCL2-like 12 (proline rich), mRNA
NCBI Official Synonym Full Names
BCL2 like 12
NCBI Official Symbol
BCL2L12
NCBI Protein Information
bcl-2-like protein 12
UniProt Protein Name
Bcl-2-like protein 12
Protein Family
UniProt Gene Name
BCL2L12
UniProt Synonym Gene Names
BPR; Bcl2-L-12
UniProt Entry Name
B2L12_HUMAN

NCBI Description

This gene encodes a member of a family of proteins containing a Bcl-2 homology domain 2 (BH2). The encoded protein is an anti-apoptotic factor that acts as an inhibitor of caspases 3 and 7 in the cytoplasm. In the nucleus, it binds to the p53 tumor suppressor protein, preventing its association with target genes. Overexpression of this gene has been detected in a number of different cancers. There is a pseudogene for this gene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Uniprot Description

Bcl-2L12: belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a Bcl-2 homology domain 2 (BH2). The function of this gene has not yet been determined. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: membrane; nucleus

Biological Process: positive regulation of transcription from RNA polymerase II promoter

Research Articles on BCL2L12

Similar Products

Product Notes

The BCL2L12 bcl2l12 (Catalog #AAA1269067) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggct ctgaagagct ggggctccgg gaagacacgc tgagggtcct agctgccttc cttaggcgtg gtgaggctgc cgggtctcct gttccaactc cacctagaag ccctgcccaa gaagagccaa cagacttcct gagccgcctt cgaagatgtc ttccctgctc cctggggcga ggagcagccc cctctgagtc ccctcggcct tgctctctgc ccatccgccc ctgctatggt ttagagcctg gcccagctac tccagacttc tatgctttgg tggcccagcg gctggaacag ctggtccaag agcagctgaa atctccgccc agcccagaat tacagggtcc cccatcgaca gagaaggaag ccatactgcg gaggctggtg gccctgctgg aggaggaggc agaagtcatt aaccagaagc tggcctcgga ccccgccctg cgcagcaagc tggtccgcct gtcctccgac tctttcgccc gcctggtgga gctgttctgt agccgggatg acagctctcg cccaagccga gcatgccccg ggccctcgcc tccttccccg gagcccctgg cccgcctggc cctagccatg gagctgagcc ggcgcgtggc cgggctgggg ggcaccctgg ccggactcag cgtggagcac gtgcacagct tcacgccctg gatccaggcc cacgggggct gggagggcat cctggctgtt tcacccgtgg acttgaactt gccattggac tga. It is sometimes possible for the material contained within the vial of "BCL2L12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.