Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCL11A cdna clone

BCL11A cDNA Clone

Gene Names
BCL11A; EVI9; CTIP1; ZNF856; HBFQTL5; BCL11A-L; BCL11A-S; BCL11a-M; BCL11A-XL
Synonyms
BCL11A; BCL11A cDNA Clone; BCL11A cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcgccgcaagcaaggcaaaccccagcacttaagcaaacgggaattctcgcccgagcctcttgaagccattcttacagatgatgaaccagaccacggcccgttgggagctccagaaggggatcatgacctcctcacctgtgggcagtgccagatgaacttcccattgggggacattcttatttttatcgagcacaaacggaaacaatgcaatggcagcctctgcttagaaaaagctgtggataagccaccttccccttcaccaatcgagatgaaaaaagcatccaatcccgtggaggttggcatccaggtcacgccagaggatgacgattgtttatcaacgtcatctagaggaatttgccccaaacaggaacacatagcagataaacttctgcactggaggggcctctcctcccctcgttctgcacatggagctctaatccccacgcctgggatgagtgcagaatatgccccgcagggtatttgtaaagatgagcccagcagctacacatgtacaacttgcaaacagccattcaccagtgcatggtttctcttgcaacacgcacagaacactcatggattaagaatctacttagaaagcgaacacggaagtcccctgaccccgcgggttggtatcccttcaggactaggtgcagaatgtccttcccagccacctctccatgggattcatattgcagacaataacccctttaacctgctaagaataccaggatcagtatcgagagaggcttccggcctggcagaagggcgctttccacccactccccccctgtttagtccaccaccgagacatcacttggacccccaccgcatagagcgcctgggggcggaagagatggccctggccacccatcacccgagtgcctttgacagggtgctgcggttgaatccaatggctatggagcctcccgccatggatttctctaggagacttagagagctggcagggaacacgtctagcccaccgctgtccccaggccggcccagccctatgcaaaggttactgcaaccattccagccaggtagcaagccgcccttcctggcgacgccccccctccctcctctgcaatccgcccctcctccctcccagcccccggtcaagtccaagtcatgcgagttctgcggcaagacgttcaaatttcagagcaacctggtggtgcaccggcgcagccacacgggcgagaagccctacaagtgcaacctgtgcgaccacgcgtgcacccaggccagcaagctgaagcgccacatgaagacgcacatgcacaaatcgtcccccatgacggtcaagtccgacgacggtctctccaccgccagctccccggaacccggcaccagcgacttggtgggcagcgccagcagcgcgctcaagtccgtggtggccaagttcaagagcgagaacgaccccaacctgatcccggagaacggggacgaggaggaagaggaggacgacgaggaagaggaagaagaggaggaagaggaggaggaggagctgacggagagcgagagggtggactacggcttcgggctgagcctggaggcggcgcgccaccacgagaacagctcgcggggcgcggtcgtgggcgtgggcgacgagagccgcgccctgcccgacgtcatgcagggcatggtgctcagctccatgcagcacttcagcgaggccttccaccaggtcctgggcgagaagcataagcgcggccacctggccgaggccgagggccacagggacacttgcgacgaagactcggtggccggcgagtcggaccgcatagacgatggcactgttaatggccgcggctgctccccgggcgagtcggcctcggggggcctgtccaaaaagctgctgctgggcagccccagctcgctgagccccttctctaagcgcatcaagctcgagaaggagttcgacctgcccccggccgcgatgcccaacacggagaacgtgtactcgcagtggctcgccggctacgcggcctccaggcagctcaaagatcccttccttagcttcggagactccagacaatcgccttttgcctcctcgtcggagcactcctcggagaacgggagcttgcgcttctccacaccgcccggggagctggacggagggatctcggggcgcagcggcacgggaagtggagggagcacgccccatattagtggtccgggcccgggcaggcccagctcaaaagagggcagacgcagcgacacttgttcttcacacacccccattcggcgtagtacccagagagctcaagatgtgtggcagttttcggatggaagctcgagagcccttaagttctga
Sequence Length
2322
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
87,554 Da
NCBI Official Full Name
Homo sapiens B-cell CLL/lymphoma 11A (zinc finger protein), mRNA
NCBI Official Synonym Full Names
B-cell CLL/lymphoma 11A
NCBI Official Symbol
BCL11A
NCBI Official Synonym Symbols
EVI9; CTIP1; ZNF856; HBFQTL5; BCL11A-L; BCL11A-S; BCL11a-M; BCL11A-XL
NCBI Protein Information
B-cell lymphoma/leukemia 11A
UniProt Protein Name
B-cell lymphoma/leukemia 11A
Protein Family
UniProt Gene Name
BCL11A
UniProt Synonym Gene Names
CTIP1; EVI9; KIAA1809; ZNF856; BCL-11A; EVI-9
UniProt Entry Name
BC11A_HUMAN

NCBI Description

This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

Bcl-11A: Functions as a myeloid and B-cell proto-oncogene. May play important roles in leukemogenesis and hematopoiesis. An essential factor in lymphopoiesis, is required for B-cell formation in fetal liver. May function as a modulator of the transcriptional repression activity of ARP1. Chromosomal aberrations involving BCL11A may be a cause of lymphoid malignancies. Translocation t(2;14)(p13;q32.3) causes BCL11A deregulation and amplification. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 2p16.1

Cellular Component: nucleoplasm

Biological Process: negative regulation of transcription from RNA polymerase II promoter; protein sumoylation; signal transduction

Research Articles on BCL11A

Similar Products

Product Notes

The BCL11A bcl11a (Catalog #AAA1268224) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcgcc gcaagcaagg caaaccccag cacttaagca aacgggaatt ctcgcccgag cctcttgaag ccattcttac agatgatgaa ccagaccacg gcccgttggg agctccagaa ggggatcatg acctcctcac ctgtgggcag tgccagatga acttcccatt gggggacatt cttattttta tcgagcacaa acggaaacaa tgcaatggca gcctctgctt agaaaaagct gtggataagc caccttcccc ttcaccaatc gagatgaaaa aagcatccaa tcccgtggag gttggcatcc aggtcacgcc agaggatgac gattgtttat caacgtcatc tagaggaatt tgccccaaac aggaacacat agcagataaa cttctgcact ggaggggcct ctcctcccct cgttctgcac atggagctct aatccccacg cctgggatga gtgcagaata tgccccgcag ggtatttgta aagatgagcc cagcagctac acatgtacaa cttgcaaaca gccattcacc agtgcatggt ttctcttgca acacgcacag aacactcatg gattaagaat ctacttagaa agcgaacacg gaagtcccct gaccccgcgg gttggtatcc cttcaggact aggtgcagaa tgtccttccc agccacctct ccatgggatt catattgcag acaataaccc ctttaacctg ctaagaatac caggatcagt atcgagagag gcttccggcc tggcagaagg gcgctttcca cccactcccc ccctgtttag tccaccaccg agacatcact tggaccccca ccgcatagag cgcctggggg cggaagagat ggccctggcc acccatcacc cgagtgcctt tgacagggtg ctgcggttga atccaatggc tatggagcct cccgccatgg atttctctag gagacttaga gagctggcag ggaacacgtc tagcccaccg ctgtccccag gccggcccag ccctatgcaa aggttactgc aaccattcca gccaggtagc aagccgccct tcctggcgac gccccccctc cctcctctgc aatccgcccc tcctccctcc cagcccccgg tcaagtccaa gtcatgcgag ttctgcggca agacgttcaa atttcagagc aacctggtgg tgcaccggcg cagccacacg ggcgagaagc cctacaagtg caacctgtgc gaccacgcgt gcacccaggc cagcaagctg aagcgccaca tgaagacgca catgcacaaa tcgtccccca tgacggtcaa gtccgacgac ggtctctcca ccgccagctc cccggaaccc ggcaccagcg acttggtggg cagcgccagc agcgcgctca agtccgtggt ggccaagttc aagagcgaga acgaccccaa cctgatcccg gagaacgggg acgaggagga agaggaggac gacgaggaag aggaagaaga ggaggaagag gaggaggagg agctgacgga gagcgagagg gtggactacg gcttcgggct gagcctggag gcggcgcgcc accacgagaa cagctcgcgg ggcgcggtcg tgggcgtggg cgacgagagc cgcgccctgc ccgacgtcat gcagggcatg gtgctcagct ccatgcagca cttcagcgag gccttccacc aggtcctggg cgagaagcat aagcgcggcc acctggccga ggccgagggc cacagggaca cttgcgacga agactcggtg gccggcgagt cggaccgcat agacgatggc actgttaatg gccgcggctg ctccccgggc gagtcggcct cggggggcct gtccaaaaag ctgctgctgg gcagccccag ctcgctgagc cccttctcta agcgcatcaa gctcgagaag gagttcgacc tgcccccggc cgcgatgccc aacacggaga acgtgtactc gcagtggctc gccggctacg cggcctccag gcagctcaaa gatcccttcc ttagcttcgg agactccaga caatcgcctt ttgcctcctc gtcggagcac tcctcggaga acgggagctt gcgcttctcc acaccgcccg gggagctgga cggagggatc tcggggcgca gcggcacggg aagtggaggg agcacgcccc atattagtgg tccgggcccg ggcaggccca gctcaaaaga gggcagacgc agcgacactt gttcttcaca cacccccatt cggcgtagta cccagagagc tcaagatgtg tggcagtttt cggatggaag ctcgagagcc cttaagttct ga. It is sometimes possible for the material contained within the vial of "BCL11A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.