BCL10 cdna clone

BCL10 cDNA Clone

Cat. Num. AAA1276144

• Gene Names: BCL10; CLAP; mE10; CIPER; IMD37; c-E10; CARMEN
• Synonyms: BCL10; BCL10 cDNA Clone; BCL10 cdna clone

• Sequence: atggagcccaccgcaccgtccctcaccgaggaggacctcactgaagtgaagaaggacgccttagaaaatttacgtgtatacctgtgtgagaaaatcatagctgagagacattttgatcatctacgtgcaaaaaaaatactcagtagagaagacactgaagaaatttcttgtcgaacatcaagtagaaaaagggctggaaaattgttagactacttacaggaaaacccaaaaggtctggacacccttgttgaatctattcggcgagaaaaaacacagaacttcctgatacagaagattacagatgaagtgctgaaacttagaaatataaaactagaacatctgaaaggactaaaatgtagcagttgtgaaccttttccagatggagccacgaacaacctctccagatcaaattcagatgagagtaatttctctgaaaaactgagggcatccactgtcatgtaccatccagaaggagaatccagcacgacgccctttttttctactaattcttctctgaatttgcctgttctagaagtaggcagaactgaaaataccatcttctcttcaactacacttcccagacctggggacccaggggctcctcctttgccaccagatctacagttagaagaagaaggaacttgtgcaaactctagtgagatgtttcttcccttaagatcacgtactgtttcacgacaatga
• Sequence Length: 702

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 31565460
• NCBI GeneID: 8915
• Molecular Weight: 26,252 Da
• NCBI Official Full Name: Homo sapiens B-cell CLL/lymphoma 10, mRNA
• NCBI Official Synonym Full Names: B-cell CLL/lymphoma 10
• NCBI Official Symbol: BCL10
• NCBI Official Synonym Symbols: CLAP; mE10; CIPER; IMD37; c-E10; CARMEN
• NCBI Protein Information: B-cell lymphoma/leukemia 10
• UniProt Protein Name: B-cell lymphoma/leukemia 10
• Protein Family: B-cell lymphoma/leukemia
• UniProt Gene Name: BCL10
• UniProt Synonym Gene Names: CIPER; CLAP; Bcl-10; hCLAP; CIPER; cCARMEN; c-E10; mE10
• UniProt Entry Name: BCL10_HUMAN

NCBI Description

This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

Bcl-10: a ubiquitous pro-apoptotic protein that promotes pro-caspase-9 maturation and activation of NF-kappa-B via NIK and IKK. May be an adapter protein between upstream TNFR1-TRADD-RIP complex and the downstream NIK-IKK-IKAP complex. Self-associates via CARD-CARD interactions; forms a tight complex with MALT1. Interacts with other CARD-proteins such as CARD9, CARD10, CARD11 and CARD14. Binds caspase-9 with its C-terminal domain. Interacts with TRAF2 and BIRC2/c-IAP2. Defects in BCL10 are involved in various types of cancer.

Protein type: Transcription, coactivator/corepressor; Tumor suppressor; Apoptosis

Chromosomal Location of Human Ortholog: 1p22

Cellular Component: cytoplasm; cytoplasmic microtubule; cytosol; lipopolysaccharide receptor complex; lysosome; nucleus; perinuclear region of cytoplasm; plasma membrane; protein complex; T cell receptor complex

Molecular Function: enzyme binding; identical protein binding; kinase activator activity; kinase binding; NF-kappaB binding; protease binding; protein binding; protein C-terminus binding; protein kinase B binding; protein kinase binding; protein self-association; transcription coactivator activity; transcription factor binding; ubiquitin binding; ubiquitin protein ligase binding

Biological Process: activation of NF-kappaB transcription factor; adaptive immune response; cell death; innate immune response; negative regulation of mature B cell apoptosis; neural tube closure; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-8 biosynthetic process; positive regulation of phosphorylation; positive regulation of protein ubiquitination; positive regulation of transcription, DNA-dependent; protein homooligomerization; protein oligomerization; response to food; response to molecule of bacterial origin; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; toll-like receptor signaling pathway

Disease: Follicular Lymphoma, Susceptibility To, 1; Gastric Lymphoma, Primary; Immunodeficiency 37; Lymphoma, Non-hodgkin, Familial; Mesothelioma, Malignant; Testicular Germ Cell Tumor