Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCAT1 cdna clone

BCAT1 cDNA Clone

Gene Names
BCAT1; BCT1; PP18; BCATC; ECA39; MECA39; PNAS121
Synonyms
BCAT1; BCAT1 cDNA Clone; BCAT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggattgcagtaacggatgctccgcagagtgtaccggagaaggaggatcaaaagaggtggtggggacttttaaggctaaagacctaatagtcacaccagctaccattttaaaggaaaaaccagaccccaataatctggtttttggaactgtgttcacggatcatatgctgacggtggagtggtcctcagagtttggatgggagaaacctcatatcaagcctcttcagaacctgtcattgcaccctggctcatcagctttgcactatgcagtggaattatttgaaggattgaaggcatttcgaggagtagataataaaattcgactgtttcagccaaacctcaacatggatagaatgtatcgctctgctgtgagggcaactctgccggtatttgacaaagaagagctcttagagtgtattcaacagcttgtgaaattggatcaagaatgggtcccatattcaacatctgctagtctgtatattcgtcctacattcattggaactgagccttctcttggagtcaagaagcctaccaaagccctgctctttgtactcttgagcccagtgggaccttatttttcaagtggaacctttaatccagtgtccctgtgggccaatcccaagtatgtaagagcctggaaaggtggaactggggactgcaagatgggagggaattacggctcatctctttttgcccaatgtgaagcagtagataatgggtgtcagcaggtcctgtggctctatggagaggaccatcagatcactgaagtgggaactatgaatctttttctttactggataaatgaagatggagaagaagaactggcaactcctccactagatggcatcattcttccaggagtgacaaggcggtgcattctggacctggcacatcagtgggacacagaactcagcttgttttcaattaatttgcctgattttctgcagttcatttacttttga
Sequence Length
963
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
586
Molecular Weight
44,131 Da
NCBI Official Full Name
Homo sapiens branched chain aminotransferase 1, cytosolic, mRNA
NCBI Official Synonym Full Names
branched chain amino acid transaminase 1
NCBI Official Symbol
BCAT1
NCBI Official Synonym Symbols
BCT1; PP18; BCATC; ECA39; MECA39; PNAS121
NCBI Protein Information
branched-chain-amino-acid aminotransferase, cytosolic
UniProt Protein Name
Branched-chain-amino-acid aminotransferase, cytosolic
UniProt Gene Name
BCAT1
UniProt Synonym Gene Names
BCT1; ECA39; BCAT(c)
UniProt Entry Name
BCAT1_HUMAN

NCBI Description

This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]

Uniprot Description

BCAT1: Catalyzes the first reaction in the catabolism of the essential branched chain amino acids leucine, isoleucine, and valine. Belongs to the class-IV pyridoxal-phosphate-dependent aminotransferase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - valine, leucine and isoleucine biosynthesis; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Cofactor and Vitamin Metabolism - pantothenate and CoA biosynthesis; EC 2.6.1.42; Transferase

Chromosomal Location of Human Ortholog: 12p12.1

Cellular Component: cytosol; mitochondrion

Molecular Function: branched-chain-amino-acid transaminase activity; pyridoxal phosphate binding

Biological Process: aspartate biosynthetic process; branched chain family amino acid biosynthetic process; branched chain family amino acid catabolic process; cell proliferation; G1/S transition of mitotic cell cycle; leucine biosynthetic process; valine biosynthetic process

Research Articles on BCAT1

Similar Products

Product Notes

The BCAT1 bcat1 (Catalog #AAA1267580) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattgca gtaacggatg ctccgcagag tgtaccggag aaggaggatc aaaagaggtg gtggggactt ttaaggctaa agacctaata gtcacaccag ctaccatttt aaaggaaaaa ccagacccca ataatctggt ttttggaact gtgttcacgg atcatatgct gacggtggag tggtcctcag agtttggatg ggagaaacct catatcaagc ctcttcagaa cctgtcattg caccctggct catcagcttt gcactatgca gtggaattat ttgaaggatt gaaggcattt cgaggagtag ataataaaat tcgactgttt cagccaaacc tcaacatgga tagaatgtat cgctctgctg tgagggcaac tctgccggta tttgacaaag aagagctctt agagtgtatt caacagcttg tgaaattgga tcaagaatgg gtcccatatt caacatctgc tagtctgtat attcgtccta cattcattgg aactgagcct tctcttggag tcaagaagcc taccaaagcc ctgctctttg tactcttgag cccagtggga ccttattttt caagtggaac ctttaatcca gtgtccctgt gggccaatcc caagtatgta agagcctgga aaggtggaac tggggactgc aagatgggag ggaattacgg ctcatctctt tttgcccaat gtgaagcagt agataatggg tgtcagcagg tcctgtggct ctatggagag gaccatcaga tcactgaagt gggaactatg aatctttttc tttactggat aaatgaagat ggagaagaag aactggcaac tcctccacta gatggcatca ttcttccagg agtgacaagg cggtgcattc tggacctggc acatcagtgg gacacagaac tcagcttgtt ttcaattaat ttgcctgatt ttctgcagtt catttacttt tga. It is sometimes possible for the material contained within the vial of "BCAT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.