Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BATF cdna clone

BATF cDNA Clone

Gene Names
BATF; SFA2; B-ATF; BATF1; SFA-2
Synonyms
BATF; BATF cDNA Clone; BATF cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcacagctccgacagcagtgactccagcttcagccgctctcctccccctggcaaacaggactcatctgatgatgtgagaagagttcagaggagggagaaaaatcgtattgccgcccagaagagccgacagaggcagacacagaaggccgacaccctgcacctggagagcgaagacctggagaaacagaacgcggctctacgcaaggagatcaagcagctcacagaggaactgaagtacttcacgtcggtgctgaacagccacgagcccctgtgctcggtgctggccgccagcacgccctcgccccccgaggtggtgtacagcgcccacgcattccaccaacctcatgtcagctccccgcgcttccagccctga
Sequence Length
378
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,120 Da
NCBI Official Full Name
Homo sapiens basic leucine zipper transcription factor, ATF-like, mRNA
NCBI Official Synonym Full Names
basic leucine zipper ATF-like transcription factor
NCBI Official Symbol
BATF
NCBI Official Synonym Symbols
SFA2; B-ATF; BATF1; SFA-2
NCBI Protein Information
basic leucine zipper transcriptional factor ATF-like
UniProt Protein Name
Basic leucine zipper transcriptional factor ATF-like
UniProt Gene Name
BATF
UniProt Synonym Gene Names
B-ATF; SFA-2
UniProt Entry Name
BATF_HUMAN

NCBI Description

The protein encoded by this gene is a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. The leucine zipper of this protein mediates dimerization with members of the Jun family of proteins. This protein is thought to be a negative regulator of AP-1/ATF transcriptional events. [provided by RefSeq, Jul 2008]

Uniprot Description

BATF: a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. Functions as a negative regulator of AP-1 mediated transcription by binding to Jun proteins. Jun/B-ATF heterodimers bind DNA preferentially at the 12-O-tetradecanoylphorbol-13- acetate response element (TRE) and weaker at the cAMP responsive region (CRE), but are transcriptionally inert.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: cytokine production; defense response to protozoan; DNA damage response, signal transduction by p53 class mediator; isotype switching; lymphoid progenitor cell differentiation; myeloid dendritic cell differentiation; response to DNA damage stimulus; T-helper 2 cell differentiation

Research Articles on BATF

Similar Products

Product Notes

The BATF batf (Catalog #AAA1267485) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcaca gctccgacag cagtgactcc agcttcagcc gctctcctcc ccctggcaaa caggactcat ctgatgatgt gagaagagtt cagaggaggg agaaaaatcg tattgccgcc cagaagagcc gacagaggca gacacagaag gccgacaccc tgcacctgga gagcgaagac ctggagaaac agaacgcggc tctacgcaag gagatcaagc agctcacaga ggaactgaag tacttcacgt cggtgctgaa cagccacgag cccctgtgct cggtgctggc cgccagcacg ccctcgcccc ccgaggtggt gtacagcgcc cacgcattcc accaacctca tgtcagctcc ccgcgcttcc agccctga. It is sometimes possible for the material contained within the vial of "BATF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.