Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAMBI cdna clone

BAMBI cDNA Clone

Gene Names
BAMBI; NMA
Synonyms
BAMBI; BAMBI cDNA Clone; BAMBI cdna clone
Ordering
For Research Use Only!
Sequence
atggatcgccactccagctacatcttcatctggctgcagctggagctctgcgccatggccgtgctgctcaccaaaggtgaaattcgatgctactgtgatgctgcccactgtgtagccactggttatatgtgtaaatctgagctcagcgcctgcttctctagacttcttgatcctcagaactcaaattccccactcacccatggctgcctggactctcttgcaagcacgacagacatctgccaagccaaacaggcccgaaaccactctggcaccaccatacccacattggaatgctgtcatgaagacatgtgcaattacagagggctgcacgatgttctctctcctcccaggggtgaggcctcaggacaaggaaacaggtatcagcatgatggtagcagaaaccttatcaccaaggtgcaggagctgacttcttccaaagagttgtggttccgggcagcggtcattgccgtgcccattgctggagggctgattttagtgttgcttattatgttggccctgaggatgcttcgaagtgaaaataagaggctgcaggatcagcggcaacagatgctctcccgtttgcactacagctttcacggacaccattccaaaaaggggcaggttgcaaagttagacttggaatgcatggtgccggtcagtgggcacgagaactgctgtctgacctgtgataaaatgagacaagcagacctcagcaacgataagatcctctcgcttgttcactggggcatgtacagtgggcacgggaagctggaattcgtatga
Sequence Length
783
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,108 Da
NCBI Official Full Name
Homo sapiens BMP and activin membrane-bound inhibitor homolog (Xenopus laevis), mRNA
NCBI Official Synonym Full Names
BMP and activin membrane bound inhibitor
NCBI Official Symbol
BAMBI
NCBI Official Synonym Symbols
NMA
NCBI Protein Information
BMP and activin membrane-bound inhibitor homolog
UniProt Protein Name
BMP and activin membrane-bound inhibitor homolog
UniProt Gene Name
BAMBI
UniProt Synonym Gene Names
NMA
UniProt Entry Name
BAMBI_HUMAN

NCBI Description

This gene encodes a transmembrane glycoprotein related to the type I receptors of the transforming growth factor-beta (TGF-beta) family, whose members play important roles in signal transduction in many developmental and pathological processes. The encoded protein however is a pseudoreceptor, lacking an intracellular serine/threonine kinase domain required for signaling. Similar proteins in frog, mouse and zebrafish function as negative regulators of TGF-beta, which has led to the suggestion that the encoded protein may function to limit the signaling range of the TGF-beta family during early embryogenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

BAMBI: Negatively regulates TGF-beta signaling. Belongs to the BAMBI family.

Protein type: Membrane protein, integral; Inhibitor

Chromosomal Location of Human Ortholog: 10p12.3-p11.2

Cellular Component: cytoplasm; plasma membrane

Molecular Function: frizzled binding; punt binding

Biological Process: cell migration; negative regulation of transforming growth factor beta receptor signaling pathway; positive regulation of cell proliferation; positive regulation of protein binding; positive regulation of transcription, DNA-dependent; regulation of cell shape

Research Articles on BAMBI

Similar Products

Product Notes

The BAMBI bambi (Catalog #AAA1267015) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcgcc actccagcta catcttcatc tggctgcagc tggagctctg cgccatggcc gtgctgctca ccaaaggtga aattcgatgc tactgtgatg ctgcccactg tgtagccact ggttatatgt gtaaatctga gctcagcgcc tgcttctcta gacttcttga tcctcagaac tcaaattccc cactcaccca tggctgcctg gactctcttg caagcacgac agacatctgc caagccaaac aggcccgaaa ccactctggc accaccatac ccacattgga atgctgtcat gaagacatgt gcaattacag agggctgcac gatgttctct ctcctcccag gggtgaggcc tcaggacaag gaaacaggta tcagcatgat ggtagcagaa accttatcac caaggtgcag gagctgactt cttccaaaga gttgtggttc cgggcagcgg tcattgccgt gcccattgct ggagggctga ttttagtgtt gcttattatg ttggccctga ggatgcttcg aagtgaaaat aagaggctgc aggatcagcg gcaacagatg ctctcccgtt tgcactacag ctttcacgga caccattcca aaaaggggca ggttgcaaag ttagacttgg aatgcatggt gccggtcagt gggcacgaga actgctgtct gacctgtgat aaaatgagac aagcagacct cagcaacgat aagatcctct cgcttgttca ctggggcatg tacagtgggc acgggaagct ggaattcgta tga. It is sometimes possible for the material contained within the vial of "BAMBI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.