BAIAP2L2 cdna clone
BAIAP2L2 cDNA Clone
Synonyms
BAIAP2L2; BAIAP2L2 cDNA Clone; BAIAP2L2 cdna clone
Sequence
atggcccccgagatggaccagttctacaggtccaccatggccatctacaagagcatcatggagcagtttaaccccgccctggagaacctggtgtacctgggcaacaactacctgcgtgccttccacgctctgtccgaggcggccgaggtctacttcagtgccatccagaagattggggagcgtgccctgcagagccccacctcacagattctgggggagatcttggtgcagatgtctgacacccagcggcacttgaactctgacctggaggtggtggtgcagacattccatggaggcctgctgcagcacatggagaagaacaccaagctggacatgcagttcatcaaagacagccgccagcactatgagctcgagtaccgccaccgagcggccaacctggagaagtgcatgtctgagctgtggcgcatggagcgcaagagagacaagaacgtgcgggagatgaaggagagtgtgaaccggctgcacgcacagatgcaggccttcgtgtctgagagtcagcgggcggctgaattggaagagaagcggcgctatcgcttcctagcagagaagcacctgctactttccaacaccttcctgcagttcttcggccgggcccgggggatgctccagaaccgcgtgctgctgtggaaggagcagtctgaggccagccgcagcccgtcgcgcgcccactcccccggcctgctgggccccgcgctggggccgccctacccctcgggccgcctgacgcccacccgcctggacatgcccccgaggcccctgggagagttcagctccccccgcagccggcacggctccggctcctacggcaccgagcccgacgcgaggcccgcgtcccagctagagccagaccgtcgctccctgccccgcacgccgtcggcctcctcgctctacagcggcagcgcccaaagctcgcgctccaactcctttggcgagcgcccgggcggcggcgggggcgccaggagagtccgcgccctggtctcccactcggagggcgccaaccacacgctgctgcgcttctccgctggggacgtggtggaggtgttggtgcccgaggcccagaacggctggctctacggcaagctggagggctcgtccgcgagcggttggttccccgaggcgtacgtgaaggctctggaggaggggcccgtgaatcccatgacccccgtgacccccatgacctccatgacctccatgtcccccatgacacccatgacacccatgaaccccgggaacgagctgccttccaggtcctacccactccggggcagccacagcctcgatgacctcctggaccggccgggcaactccaccccaagccgggtgccaagccgtgcccccagccctgcacctccacccttgcccagcagccgccgcagcagcatgggcagcacagcagttgccactgacgtcaagaaactgatgtcctcagagcagtacccaccacaggagctcttcccgaggggcacaaatccttttgccactgtcaagcttcgtcccaccatcaccaatgaccgctcagcacccctcatccgctga
Sequence Length
1557
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
57,353 Da
NCBI Official Full Name
Homo sapiens BAI1-associated protein 2-like 2, mRNA
NCBI Official Synonym Full Names
BAI1 associated protein 2 like 2
NCBI Official Symbol
BAIAP2L2
NCBI Protein Information
brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 2
UniProt Protein Name
Brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 2
UniProt Gene Name
BAIAP2L2
UniProt Synonym Gene Names
BAI1-associated protein 2-like protein 2; Pinkbar
UniProt Entry Name
BI2L2_HUMAN
NCBI Description
The protein encoded by this gene binds phosphoinositides and promotes the formation of planar or curved membrane structures. The encoded protein is found in RAB13-positive vesicles and at intercellular contacts with the plasma membrane. [provided by RefSeq, Dec 2012]
Uniprot Description
BAIAP2L2: Phosphoinositides-binding protein that induces the formation of planar or gently curved membrane structures. Binds to phosphoinositides, including to phosphatidylinositol 4,5- bisphosphate (PtdIns(4,5)P2) headgroups. There seems to be no clear preference for a specific phosphoinositide. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 22q13.1
Cellular Component: actin cytoskeleton; cytosol; vesicle membrane
Molecular Function: cytoskeletal adaptor activity; phospholipid binding
Biological Process: actin crosslink formation; actin filament bundle formation; insulin receptor signaling pathway; positive regulation of actin filament polymerization
Similar Products
Product Notes
The BAIAP2L2 baiap2l2 (Catalog #AAA1274902) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccccg agatggacca gttctacagg tccaccatgg ccatctacaa gagcatcatg gagcagttta accccgccct ggagaacctg gtgtacctgg gcaacaacta cctgcgtgcc ttccacgctc tgtccgaggc ggccgaggtc tacttcagtg ccatccagaa gattggggag cgtgccctgc agagccccac ctcacagatt ctgggggaga tcttggtgca gatgtctgac acccagcggc acttgaactc tgacctggag gtggtggtgc agacattcca tggaggcctg ctgcagcaca tggagaagaa caccaagctg gacatgcagt tcatcaaaga cagccgccag cactatgagc tcgagtaccg ccaccgagcg gccaacctgg agaagtgcat gtctgagctg tggcgcatgg agcgcaagag agacaagaac gtgcgggaga tgaaggagag tgtgaaccgg ctgcacgcac agatgcaggc cttcgtgtct gagagtcagc gggcggctga attggaagag aagcggcgct atcgcttcct agcagagaag cacctgctac tttccaacac cttcctgcag ttcttcggcc gggcccgggg gatgctccag aaccgcgtgc tgctgtggaa ggagcagtct gaggccagcc gcagcccgtc gcgcgcccac tcccccggcc tgctgggccc cgcgctgggg ccgccctacc cctcgggccg cctgacgccc acccgcctgg acatgccccc gaggcccctg ggagagttca gctccccccg cagccggcac ggctccggct cctacggcac cgagcccgac gcgaggcccg cgtcccagct agagccagac cgtcgctccc tgccccgcac gccgtcggcc tcctcgctct acagcggcag cgcccaaagc tcgcgctcca actcctttgg cgagcgcccg ggcggcggcg ggggcgccag gagagtccgc gccctggtct cccactcgga gggcgccaac cacacgctgc tgcgcttctc cgctggggac gtggtggagg tgttggtgcc cgaggcccag aacggctggc tctacggcaa gctggagggc tcgtccgcga gcggttggtt ccccgaggcg tacgtgaagg ctctggagga ggggcccgtg aatcccatga cccccgtgac ccccatgacc tccatgacct ccatgtcccc catgacaccc atgacaccca tgaaccccgg gaacgagctg ccttccaggt cctacccact ccggggcagc cacagcctcg atgacctcct ggaccggccg ggcaactcca ccccaagccg ggtgccaagc cgtgccccca gccctgcacc tccacccttg cccagcagcc gccgcagcag catgggcagc acagcagttg ccactgacgt caagaaactg atgtcctcag agcagtaccc accacaggag ctcttcccga ggggcacaaa tccttttgcc actgtcaagc ttcgtcccac catcaccaat gaccgctcag cacccctcat ccgctga. It is sometimes possible for the material contained within the vial of "BAIAP2L2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
