AVPI1 cdna clone
AVPI1 cDNA Clone
Gene Names
AVPI1; VIP32; VIT32; PP5395
Synonyms
AVPI1; AVPI1 cDNA Clone; AVPI1 cdna clone
Sequence
atgggtaccccagcctcggtggtcagtgagccacccccttggcaggccccgattgaggcccggggccgcaagcaggcctcagccaacatcttccaggacgccgagctgctgcagatccaaggcctgtttcaacgcagcggggaccagctggccgaggaacgggcacagatcatctgggaatgtgcaggggaccaccgtgtggctgaggccctcaagaggctgcgcaggaagaggcccccaaggcagaaacccctgggccactcgctacaccactgcagccgcctcagaatcctggagccccactctgcactggccaacccacagagtgccacagagacagcctccagtgagcagtatctgcactctaggaagaaaagtgccaggatccgccggaactggaggaagtcaggccccacaagctacctccaccagatcagacactga
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
16,773 Da
NCBI Official Full Name
Homo sapiens arginine vasopressin-induced 1, mRNA
NCBI Official Synonym Full Names
arginine vasopressin induced 1
NCBI Official Symbol
AVPI1
NCBI Official Synonym Symbols
VIP32; VIT32; PP5395
NCBI Protein Information
arginine vasopressin-induced protein 1
UniProt Protein Name
Arginine vasopressin-induced protein 1
Protein Family
UniProt Gene Name
AVPI1
UniProt Synonym Gene Names
AVP-induced protein 1
UniProt Entry Name
AVPI1_HUMAN
Uniprot Description
AVPI1: May be involved in MAP kinase activation, epithelial sodium channel (ENaC) down-regulation and cell cycling.
Chromosomal Location of Human Ortholog: 10q24.2
Molecular Function: protein binding
Research Articles on AVPI1
Similar Products
Product Notes
The AVPI1 avpi1 (Catalog #AAA1267549) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaccc cagcctcggt ggtcagtgag ccaccccctt ggcaggcccc gattgaggcc cggggccgca agcaggcctc agccaacatc ttccaggacg ccgagctgct gcagatccaa ggcctgtttc aacgcagcgg ggaccagctg gccgaggaac gggcacagat catctgggaa tgtgcagggg accaccgtgt ggctgaggcc ctcaagaggc tgcgcaggaa gaggccccca aggcagaaac ccctgggcca ctcgctacac cactgcagcc gcctcagaat cctggagccc cactctgcac tggccaaccc acagagtgcc acagagacag cctccagtga gcagtatctg cactctagga agaaaagtgc caggatccgc cggaactgga ggaagtcagg ccccacaagc tacctccacc agatcagaca ctga. It is sometimes possible for the material contained within the vial of "AVPI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
