Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP5J cdna clone

ATP5J cDNA Clone

Gene Names
ATP5J; F6; CF6; ATP5; ATPM; ATP5A
Synonyms
ATP5J; ATP5J cDNA Clone; ATP5J cdna clone
Ordering
For Research Use Only!
Sequence
atgattcttcagaggctcttcaggttctcctctgtcattcggtcagccgtctcagtccatttgcggaggaacattggtgttacagcagtggcatttaataaggaacttgatcctatacagaaactctttgtggacaagattagagaatacaaatctaagcgacagacatctggaggacctgttgatgctagttcagagtatcagcaagagctggagagggagctttttaagctcaagcaaatgtttggtaatgcagacatgaatacatttcccaccttcaaatttgaagatcccaaatttgaagtcatcgaaaaaccccaggcctga
Sequence Length
327
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
522
Molecular Weight
13,388 Da
NCBI Official Full Name
Homo sapiens ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6, mRNA
NCBI Official Synonym Full Names
ATP synthase, H+ transporting, mitochondrial Fo complex subunit F6
NCBI Official Symbol
ATP5J
NCBI Official Synonym Symbols
F6; CF6; ATP5; ATPM; ATP5A
NCBI Protein Information
ATP synthase-coupling factor 6, mitochondrial
UniProt Protein Name
ATP synthase-coupling factor 6, mitochondrial
UniProt Gene Name
ATP5J
UniProt Synonym Gene Names
ATP5A; ATPM; ATPase subunit F6
UniProt Entry Name
ATP5J_HUMAN

NCBI Description

Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016]

Uniprot Description

ATP5J: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain and the peripheric stalk, which acts as a stator to hold the catalytic alpha(3)beta(3) subcomplex and subunit a/ATP6 static relative to the rotary elements. Also involved in the restoration of oligomycin-sensitive ATPase activity to depleted F1-F0 complexes. Belongs to the eukaryotic ATPase subunit F6 family.

Protein type: Energy Metabolism - oxidative phosphorylation; Mitochondrial; EC 3.6.3.14

Chromosomal Location of Human Ortholog: 21q21.1

Cellular Component: mitochondrial inner membrane; mitochondrial proton-transporting ATP synthase complex; mitochondrion

Molecular Function: ATPase activity; transmembrane transporter activity

Biological Process: ATP biosynthetic process; mitochondrial ATP synthesis coupled proton transport; substantia nigra development

Research Articles on ATP5J

Similar Products

Product Notes

The ATP5J atp5j (Catalog #AAA1267878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcttc agaggctctt caggttctcc tctgtcattc ggtcagccgt ctcagtccat ttgcggagga acattggtgt tacagcagtg gcatttaata aggaacttga tcctatacag aaactctttg tggacaagat tagagaatac aaatctaagc gacagacatc tggaggacct gttgatgcta gttcagagta tcagcaagag ctggagaggg agctttttaa gctcaagcaa atgtttggta atgcagacat gaatacattt cccaccttca aatttgaaga tcccaaattt gaagtcatcg aaaaacccca ggcctga. It is sometimes possible for the material contained within the vial of "ATP5J, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.