ATP5H cdna clone

ATP5H

Cat. Num. AAA200941

• Gene Names: ATP5PD; ATPQ; APT5H; ATP5H
• Synonyms: ATP5H; ATPQ; ATP5H cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAATGTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAAAGAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAA; ; Translation Sequence: MAGRKLALKT IDWVAFAEII PQNQKAIASS LKSWNETLTS RLAALPENPP AIDWAYYKAN VAKAGLVDDF EKKFNALKVP VPEDKYTAQV DAEEKEDVKS CAEWVSLSKA RIVEYEKEME KMKNLIPFDQ MTIEDLNEAF PETKLDKKKY PYWPHQPIEN L
• Sequence Length: 161

• Species: Human
• Chromosome Location: 17q25
• cDNA Size: 486bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for ATP5H cdna clone

ATP5H belongs to the ATPase d subunit family. ATP5H exists as two alternatively spliced isoforms and is encoded by a gene that maps to human chromosome 17q25.

Product Categories/Family for ATP5H cdna clone

Metabolism

NCBI and Uniprot Product Information

• NCBI GI #: 5453559
• NCBI GeneID: 10476
• NCBI Accession #: NP_006347.1
• NCBI GenBank Nucleotide #: NM_006356.2
• UniProt Accession #: O75947
• NCBI Official Full Name: ATP synthase subunit d, mitochondrial isoform a
• NCBI Official Synonym Full Names: ATP synthase peripheral stalk subunit d
• NCBI Official Symbol: ATP5PD
• NCBI Official Synonym Symbols: ATPQ; APT5H; ATP5H
• NCBI Protein Information: ATP synthase subunit d, mitochondrial
• UniProt Protein Name: ATP synthase subunit d, mitochondrial
• UniProt Gene Name: ATP5H
• UniProt Synonym Gene Names: ATPase subunit d
• UniProt Entry Name: ATP5H_HUMAN

NCBI Description

Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010]

Uniprot Description

ATP5H: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain and the peripheric stalk, which acts as a stator to hold the catalytic alpha(3)beta(3) subcomplex and subunit a/ATP6 static relative to the rotary elements. Belongs to the ATPase d subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.3.14; Mitochondrial; Energy Metabolism - oxidative phosphorylation

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: nucleoplasm; mitochondrion; mitochondrial inner membrane; cytoplasm; mitochondrial proton-transporting ATP synthase complex

Molecular Function: ATPase activity; hydrogen ion transmembrane transporter activity; transmembrane transporter activity

Biological Process: cellular metabolic process; mitochondrial ATP synthesis coupled proton transport