Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP5A1 cdna clone

ATP5A1 cDNA Clone

Gene Names
ATP5A1; OMR; ORM; ATPM; MOM2; ATP5A; hATP1; MC5DN4; ATP5AL2; COXPD22; HEL-S-123m
Synonyms
ATP5A1; ATP5A1 cDNA Clone; ATP5A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtccgtgcgcgttgctgcggccgtggtccgcgcccttcctcggcgggccggactggtctccagaaatgctttgggttcatctttcattgctgcaaggaacttccatgcctctaacactcatcttcaaaagactgggactgctgagatgtcctctattcttgaagagcgtattcttggagctgatacctctgttgatcttgaagaaactgggcgtgtcttaagtattggtgatggtattgcccgcgtacatgggctgaggaatgttcaagcagaagaaatggtagagttttcttcaggcttaaagggtatgtccttgaacttggaacctgacaatgttggtgttgtcgtgtttggaaatgataaactaattaaggaaggagatatagtgaagaggacaggagccattgtggacgttccagttggtgaggagctgttgggtcgtgtagttgatgcccttggtaatgctattgatggaaagggtccaattggttccaagacgcgtaggcgagttggtctgaaagcccccggtatcattcctcgaatttcagtgcgggaaccaatgcagactggcattaaggctgtggatagcttggtgccaattggtcgtggtcagcgtgaactgattattggtgaccgacagactgggaaaacctcaattgctattgacacaatcattaaccagaaacgtttcaatgatggatctgatgaaaagaagaagctgtactgtatttatgttgctattggtcaaaagagatccactgttgcccagttggtgaagagacttacagatgcagatgccatgaagtacaccattgtggtgtcggctacggcctcggatgctgccccacttcagtacctggctccttactctggctgttccatgggagagtattttagagacaatggcaaacatgctttgatcatctatgacgacttatccaaacaggctgttgcttaccgtcagatgtctctgttgctccgccgaccccctggtcgtgaggcctatcctggtgatgtgttctacctacactcccggttgctggagagagcagccaaaatgaacgatgcttttggtggtggctccttgactgctttgccagtcatagaaacacaggctggtgatgtgtctgcttacattccaacaaatgtcatttccatcactgacggacagatcttcttggaaacagaattgttctacaaaggtatccgccctgcaattaacgttggtctgtctgtatctcgtgtcggatccgctgcccaaaccagggctatgaagcaggtagcaggtaccatgaagctggaattggctcagtatcgtgaggttgctgcttttgcccagttcggttctgacctcgatgctgccactcaacaacttttgagtcgtggcgtgcgtctaactgagttgctgaagcaaggacagtattctcccatggctattgaagaacaagtggctgttatctatgcgggtgtaaggggatatcttgataaactggagcccagcaagattacaaagtttgagaatgctttcttgtctcatgtcgtcagccagcaccaagccttgttgggcactatcagggctgatggaaagatctcagaacaatcagatgcaaagctgaaagagattgtaacaaatttcttggctggatttgaagcttaa
Sequence Length
1662
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
498
Molecular Weight
57,547 Da
NCBI Official Full Name
Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle, mRNA
NCBI Official Synonym Full Names
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
NCBI Official Symbol
ATP5A1
NCBI Official Synonym Symbols
OMR; ORM; ATPM; MOM2; ATP5A; hATP1; MC5DN4; ATP5AL2; COXPD22; HEL-S-123m
NCBI Protein Information
ATP synthase subunit alpha, mitochondrial
UniProt Protein Name
ATP synthase subunit alpha, mitochondrial
UniProt Gene Name
ATP5A1
UniProt Synonym Gene Names
ATP5A; ATP5AL2; ATPM
UniProt Entry Name
ATPA_HUMAN

NCBI Description

This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]

Uniprot Description

ATP5A1: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Subunits alpha and beta form the catalytic core in F(1). Rotation of the central stalk against the surrounding alpha(3)beta(3) subunits leads to hydrolysis of ATP in three separate catalytic sites on the beta subunits. Subunit alpha does not bear the catalytic high-affinity ATP-binding sites. Belongs to the ATPase alpha/beta chains family.

Protein type: Transporter; Membrane protein, integral; Hydrolase; Mitochondrial; Energy Metabolism - oxidative phosphorylation; EC 3.6.3.14

Chromosomal Location of Human Ortholog: 18q21

Cellular Component: extracellular matrix; membrane; mitochondrial inner membrane; mitochondrial matrix; mitochondrial proton-transporting ATP synthase complex; mitochondrion; plasma membrane; signalosome

Molecular Function: ATP binding; ATPase activity; hydrogen ion transporting ATP synthase activity, rotational mechanism; MHC class I protein binding; protein binding; transmembrane transporter activity

Biological Process: ATP biosynthetic process; embryonic development; lipid metabolic process; mitochondrial ATP synthesis coupled proton transport; negative regulation of endothelial cell proliferation

Disease: Combined Oxidative Phosphorylation Deficiency 22; Mitochondrial Complex V (atp Synthase) Deficiency, Nuclear Type 4

Research Articles on ATP5A1

Similar Products

Product Notes

The ATP5A1 atp5a1 (Catalog #AAA1274342) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtccg tgcgcgttgc tgcggccgtg gtccgcgccc ttcctcggcg ggccggactg gtctccagaa atgctttggg ttcatctttc attgctgcaa ggaacttcca tgcctctaac actcatcttc aaaagactgg gactgctgag atgtcctcta ttcttgaaga gcgtattctt ggagctgata cctctgttga tcttgaagaa actgggcgtg tcttaagtat tggtgatggt attgcccgcg tacatgggct gaggaatgtt caagcagaag aaatggtaga gttttcttca ggcttaaagg gtatgtcctt gaacttggaa cctgacaatg ttggtgttgt cgtgtttgga aatgataaac taattaagga aggagatata gtgaagagga caggagccat tgtggacgtt ccagttggtg aggagctgtt gggtcgtgta gttgatgccc ttggtaatgc tattgatgga aagggtccaa ttggttccaa gacgcgtagg cgagttggtc tgaaagcccc cggtatcatt cctcgaattt cagtgcggga accaatgcag actggcatta aggctgtgga tagcttggtg ccaattggtc gtggtcagcg tgaactgatt attggtgacc gacagactgg gaaaacctca attgctattg acacaatcat taaccagaaa cgtttcaatg atggatctga tgaaaagaag aagctgtact gtatttatgt tgctattggt caaaagagat ccactgttgc ccagttggtg aagagactta cagatgcaga tgccatgaag tacaccattg tggtgtcggc tacggcctcg gatgctgccc cacttcagta cctggctcct tactctggct gttccatggg agagtatttt agagacaatg gcaaacatgc tttgatcatc tatgacgact tatccaaaca ggctgttgct taccgtcaga tgtctctgtt gctccgccga ccccctggtc gtgaggccta tcctggtgat gtgttctacc tacactcccg gttgctggag agagcagcca aaatgaacga tgcttttggt ggtggctcct tgactgcttt gccagtcata gaaacacagg ctggtgatgt gtctgcttac attccaacaa atgtcatttc catcactgac ggacagatct tcttggaaac agaattgttc tacaaaggta tccgccctgc aattaacgtt ggtctgtctg tatctcgtgt cggatccgct gcccaaacca gggctatgaa gcaggtagca ggtaccatga agctggaatt ggctcagtat cgtgaggttg ctgcttttgc ccagttcggt tctgacctcg atgctgccac tcaacaactt ttgagtcgtg gcgtgcgtct aactgagttg ctgaagcaag gacagtattc tcccatggct attgaagaac aagtggctgt tatctatgcg ggtgtaaggg gatatcttga taaactggag cccagcaaga ttacaaagtt tgagaatgct ttcttgtctc atgtcgtcag ccagcaccaa gccttgttgg gcactatcag ggctgatgga aagatctcag aacaatcaga tgcaaagctg aaagagattg taacaaattt cttggctgga tttgaagctt aa. It is sometimes possible for the material contained within the vial of "ATP5A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.