Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATOH7 cdna clone

ATOH7 cDNA Clone

Gene Names
ATOH7; Math5; NCRNA; RNANC; PHPVAR; bHLHa13
Synonyms
ATOH7; ATOH7 cDNA Clone; ATOH7 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtcctgcaagcccagcggcccgccggcgggagcgcgcgttgcacccccgtgcgcgggcggcaccgagtgcgcgggcacgtgcgccggggccgggcggctggagagcgcggcgcgcaggcgcctggcggccaacgcgcgcgagcgccgccgcatgcaggggctcaacactgccttcgaccgcttacgcagggtggttccccagtggggccaggataaaaagctgtccaagtacgagaccctgcagatggccctgagctacatcatggctctgacccggatcctggccgaggccgagcgattcggctcggagcgggactgggtgggtctccactgtgagcacttcggccgcgaccactacctcccgttcccgggcgcgaagctgccgggcgagagcgagctgtacagccagagactcttcggcttccagcccgagcccttccagatggccacctag
Sequence Length
459
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,871 Da
NCBI Official Full Name
Homo sapiens atonal homolog 7 (Drosophila), mRNA
NCBI Official Synonym Full Names
atonal bHLH transcription factor 7
NCBI Official Symbol
ATOH7
NCBI Official Synonym Symbols
Math5; NCRNA; RNANC; PHPVAR; bHLHa13
NCBI Protein Information
protein atonal homolog 7
UniProt Protein Name
Protein atonal homolog 7
Protein Family
UniProt Gene Name
ATOH7
UniProt Synonym Gene Names
ATH5; BHLHA13; bHLHa13; hATH5
UniProt Entry Name
ATOH7_HUMAN

NCBI Description

This intronless gene encodes a member of the basic helix-loop-helix family of transcription factors, with similarity to Drosophila atonal gene that controls photoreceptor development. Studies in mice suggest that this gene plays a central role in retinal ganglion cell and optic nerve formation. Mutations in this gene are associated with nonsyndromic congenital retinal nonattachment. [provided by RefSeq, Dec 2011]

Uniprot Description

ATOH7: Transcription factor involved in the differentiation of retinal ganglion cells. Defects in ATOH7 are the cause of retinal non-attachment congenital non-syndromic (RNANC). A condition characterized by separation of the inner layers of the retina (neural retina) from the pigment epithelium. Clinical findings include lack of perception of light, massive retrolental mass, shallow anterior chamber, and nystagmus in otherwise normal individuals. RNANC is caused by a 6.5 kb deletion that spans a remote cis regulatory element 20 kb upstream from ATOH7.

Chromosomal Location of Human Ortholog: 10q21.3|10q21.3-q22.1

Biological Process: optic nerve development

Disease: Persistent Hyperplastic Primary Vitreous, Autosomal Recessive

Research Articles on ATOH7

Similar Products

Product Notes

The ATOH7 atoh7 (Catalog #AAA1268110) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtcct gcaagcccag cggcccgccg gcgggagcgc gcgttgcacc cccgtgcgcg ggcggcaccg agtgcgcggg cacgtgcgcc ggggccgggc ggctggagag cgcggcgcgc aggcgcctgg cggccaacgc gcgcgagcgc cgccgcatgc aggggctcaa cactgccttc gaccgcttac gcagggtggt tccccagtgg ggccaggata aaaagctgtc caagtacgag accctgcaga tggccctgag ctacatcatg gctctgaccc ggatcctggc cgaggccgag cgattcggct cggagcggga ctgggtgggt ctccactgtg agcacttcgg ccgcgaccac tacctcccgt tcccgggcgc gaagctgccg ggcgagagcg agctgtacag ccagagactc ttcggcttcc agcccgagcc cttccagatg gccacctag. It is sometimes possible for the material contained within the vial of "ATOH7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.