ATL2 cdna clone
ATL2 cDNA Clone
Gene Names
ATL2; aip-2; ARL3IP2; ARL6IP2; atlastin2
Synonyms
ATL2; ATL2 cDNA Clone; ATL2 cdna clone
Sequence
atggatacccagggtgcctttgatagccagtcaactatcaaagactgtgcaacggtgtttgctctgagcactatgactagctctgtccaggtatataatctgtctcagaatattcaagaagatgatcttcaacatttgcaattatttacagagtatggaagacttgcgatggaagaaatctaccagaaaccatttcagacattaatgtttttgattcgagattggagctatccttatgaacattcatatggtttggaaggtggaaagcaatttcttgaaaagagattacaggtaaaacaaaatcaacatgaagagcttcagaatgtaaggaagcacatacacaattgtttctcaaatcttggttgcttccttttgccacatcctggtcttaaagttgcaactaatcctagttttgatgggagattgaaagatattgatgaagactttaaacgcgagcttcgaaatctggttccattgctgcttgcccctgaaaatttggtagaaaaagagataagtggatctaaagtcacttgtagagatcttgtagaatattttaaggcttacatcaaaatctatcaaggagaagaacttccacatccaaagtccatgcttcaggcaacagctgaagctaataatcttgctgcagtagcaggagcaagagatacctattgtaaaagtatggaacaggtatgtggaggggacaagccttacattgcaccttcagatctggagcgaaaacacttggatctcaaggaagtggcgataaaacaatttcgttcagtaaaaaagatgggtggagatgagttctgccgtcgttatcaggaccagcttgaagctgaaattgaagaaacctatgcaaattttataaagcacaatgatggcaaaaatatcttctatgctgctcgtaccccagccacactgtttgcggtcatgtttgctatgtatataatctcaggactgactggcttcattggcctaaactctatagctgtcttgtgtaaccttgtcatggggttagcactgatatttctttgtacttgggcatatgttaaatactctggggagttcagagaaattggaacagtgattgatcagattgctgaaacactatgggaacaggtattgaagcccctgggtgataatttgatggaggaaaacataaggcagtctgtaacaaactctatcaaagcaggcctgactgaccaggtgtctcatcatgccagattaaagacagactga
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,522 Da
NCBI Official Full Name
Homo sapiens atlastin GTPase 2, mRNA
NCBI Official Synonym Full Names
atlastin GTPase 2
NCBI Official Symbol
ATL2
NCBI Official Synonym Symbols
aip-2; ARL3IP2; ARL6IP2; atlastin2
NCBI Protein Information
atlastin-2
UniProt Protein Name
Atlastin-2
Protein Family
UniProt Gene Name
ATL2
UniProt Synonym Gene Names
ARL6IP2; ARL-6-interacting protein 2; Aip-2
UniProt Entry Name
ATLA2_HUMAN
Uniprot Description
ARL6IP2: GTPase tethering membranes through formation of trans- homooligomer and mediating homotypic fusion of endoplasmic reticulum membranes. Functions in endoplasmic reticulum tubular network biogenesis. Belongs to the GBP family. Atlastin subfamily. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.6.5.-; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 2p22.3
Cellular Component: endoplasmic reticulum; integral to membrane; membrane
Molecular Function: identical protein binding; protein binding
Biological Process: endoplasmic reticulum organization and biogenesis; ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; protein homooligomerization
Research Articles on ATL2
Similar Products
Product Notes
The ATL2 atl2 (Catalog #AAA1275544) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggataccc agggtgcctt tgatagccag tcaactatca aagactgtgc aacggtgttt gctctgagca ctatgactag ctctgtccag gtatataatc tgtctcagaa tattcaagaa gatgatcttc aacatttgca attatttaca gagtatggaa gacttgcgat ggaagaaatc taccagaaac catttcagac attaatgttt ttgattcgag attggagcta tccttatgaa cattcatatg gtttggaagg tggaaagcaa tttcttgaaa agagattaca ggtaaaacaa aatcaacatg aagagcttca gaatgtaagg aagcacatac acaattgttt ctcaaatctt ggttgcttcc ttttgccaca tcctggtctt aaagttgcaa ctaatcctag ttttgatggg agattgaaag atattgatga agactttaaa cgcgagcttc gaaatctggt tccattgctg cttgcccctg aaaatttggt agaaaaagag ataagtggat ctaaagtcac ttgtagagat cttgtagaat attttaaggc ttacatcaaa atctatcaag gagaagaact tccacatcca aagtccatgc ttcaggcaac agctgaagct aataatcttg ctgcagtagc aggagcaaga gatacctatt gtaaaagtat ggaacaggta tgtggagggg acaagcctta cattgcacct tcagatctgg agcgaaaaca cttggatctc aaggaagtgg cgataaaaca atttcgttca gtaaaaaaga tgggtggaga tgagttctgc cgtcgttatc aggaccagct tgaagctgaa attgaagaaa cctatgcaaa ttttataaag cacaatgatg gcaaaaatat cttctatgct gctcgtaccc cagccacact gtttgcggtc atgtttgcta tgtatataat ctcaggactg actggcttca ttggcctaaa ctctatagct gtcttgtgta accttgtcat ggggttagca ctgatatttc tttgtacttg ggcatatgtt aaatactctg gggagttcag agaaattgga acagtgattg atcagattgc tgaaacacta tgggaacagg tattgaagcc cctgggtgat aatttgatgg aggaaaacat aaggcagtct gtaacaaact ctatcaaagc aggcctgact gaccaggtgt ctcatcatgc cagattaaag acagactga. It is sometimes possible for the material contained within the vial of "ATL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
