ATG9A cdna clone
ATG9A cDNA Clone
Gene Names
ATG9A; mATG9; APG9L1; MGD3208
Synonyms
ATG9A; ATG9A cDNA Clone; ATG9A cdna clone
Sequence
atggcgcagtttgacactgaataccagcgcctagaggcctcctatagtgattcacccccaggggaggaggacctgttggtgcacgtcgccgaggggagcaagtcaccttggcaccatattgaaaaccttgacctcttcttctctcgagtttataatctgcaccagaagaatggcttcacatgtatgctcatcggggagatctttgagctcatgcagttcctctttgtggttgccttcactaccttcctggtcagctgcgtggactatgacatcctatttgccaacaagatggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacatttgctgctactgggagatccactccttctacctgcacgctctgcgcatccctatgtctgcccttccgtattgcacgtggcaagaagtgcaggcccggatcgtgcagacgcagaaggagcaccagatctgcatccacaaacgtgagctgacagaactggacatctaccaccgcatcctccgtttccagaactacatggtggcactggttaacaaatccctcctgcctctgcgcttccgcctgcctggcctcggggaagctgtcttcttcacccgtggtctcaagtacaactttgagctgatcctcttctggggacctggctctctgtttctcaatgaatggagcctcaaggccgagtacaaacgtggggggcaacggctagagctggcccagcgcctcagcaaccgcatcctgtggattggcatcgctaacttcctgctgtgccccctcatcctcatatggcaaatcctctatgccttcttcagctatgctgaggtgctgaagcgggagccgggggccctgggagcacgctgctggtcactctatggccgctgctacctccgccacttcaacgagctggagcacgagctgcagtcccgcctcaaccgtggctacaagcccgcctccaagtacatgaattgcttcttgtcacctcttttgacactgctggccaagaatggaaccttcttcgctggctccatcctggctgtgcttattgccctcaccatttatgacgaagatgtgttggctgtggaacatgtgctgaccaccgtcacactcctgggggtcaccgtgaccgtgtgcaggtcctttatcccggaccagcacatggtgttctgccctgagcagctgctccgcgtgatcctcgctcacatccactacatgcctgaccactggcagggtgttcattttggaagagttgctgagccccattgtcacacccctcatcctcatcttctgcctgcgcccacgggccctggagattatagacttcttccgaaacttcaccgtggaggtcgttggtgtgggagatacctgctcctttgctcagatggatgttcgccagcatggtcatccccagtggctatctgctgggcagacagaggcctcagtgtaccagcaagctga
Sequence Length
1587
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,694 Da
NCBI Official Full Name
Homo sapiens ATG9 autophagy related 9 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 9A
NCBI Official Symbol
ATG9A
NCBI Official Synonym Symbols
mATG9; APG9L1; MGD3208
NCBI Protein Information
autophagy-related protein 9A
UniProt Protein Name
Autophagy-related protein 9A
Protein Family
UniProt Gene Name
ATG9A
UniProt Synonym Gene Names
APG9L1
UniProt Entry Name
ATG9A_HUMAN
Uniprot Description
ATG9A: Plays a role in autophagy. Cycles between a juxta- nuclear trans-Golgi network compartment and late endosomes. Nutrient starvation induces accumulation on autophagosomes. Starvation-dependent trafficking requires ULK1, ATG13 and FAM48A. Interacts with FAM48A. Belongs to the ATG9 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Autophagy; Membrane protein, integral; Vesicle; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 2q35
Cellular Component: endosome; late endosome; membrane; recycling endosome; trans-Golgi network
Molecular Function: protein binding
Biological Process: autophagic vacuole formation; mitochondrion degradation
Research Articles on ATG9A
Similar Products
Product Notes
The ATG9A atg9a (Catalog #AAA1266511) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcagt ttgacactga ataccagcgc ctagaggcct cctatagtga ttcaccccca ggggaggagg acctgttggt gcacgtcgcc gaggggagca agtcaccttg gcaccatatt gaaaaccttg acctcttctt ctctcgagtt tataatctgc accagaagaa tggcttcaca tgtatgctca tcggggagat ctttgagctc atgcagttcc tctttgtggt tgccttcact accttcctgg tcagctgcgt ggactatgac atcctatttg ccaacaagat ggtgaaccac agtcttcacc ctactgaacc cgtcaaggtc actctgccag acgccttttt gcctgctcaa gtctgtagtg ccaggattca ggaaaatggc tcccttatca ccatcctggt cattgctggt gtcttctgga tccaccggct tatcaagttc atctataaca tttgctgcta ctgggagatc cactccttct acctgcacgc tctgcgcatc cctatgtctg cccttccgta ttgcacgtgg caagaagtgc aggcccggat cgtgcagacg cagaaggagc accagatctg catccacaaa cgtgagctga cagaactgga catctaccac cgcatcctcc gtttccagaa ctacatggtg gcactggtta acaaatccct cctgcctctg cgcttccgcc tgcctggcct cggggaagct gtcttcttca cccgtggtct caagtacaac tttgagctga tcctcttctg gggacctggc tctctgtttc tcaatgaatg gagcctcaag gccgagtaca aacgtggggg gcaacggcta gagctggccc agcgcctcag caaccgcatc ctgtggattg gcatcgctaa cttcctgctg tgccccctca tcctcatatg gcaaatcctc tatgccttct tcagctatgc tgaggtgctg aagcgggagc cgggggccct gggagcacgc tgctggtcac tctatggccg ctgctacctc cgccacttca acgagctgga gcacgagctg cagtcccgcc tcaaccgtgg ctacaagccc gcctccaagt acatgaattg cttcttgtca cctcttttga cactgctggc caagaatgga accttcttcg ctggctccat cctggctgtg cttattgccc tcaccattta tgacgaagat gtgttggctg tggaacatgt gctgaccacc gtcacactcc tgggggtcac cgtgaccgtg tgcaggtcct ttatcccgga ccagcacatg gtgttctgcc ctgagcagct gctccgcgtg atcctcgctc acatccacta catgcctgac cactggcagg gtgttcattt tggaagagtt gctgagcccc attgtcacac ccctcatcct catcttctgc ctgcgcccac gggccctgga gattatagac ttcttccgaa acttcaccgt ggaggtcgtt ggtgtgggag atacctgctc ctttgctcag atggatgttc gccagcatgg tcatccccag tggctatctg ctgggcagac agaggcctca gtgtaccagc aagctga. It is sometimes possible for the material contained within the vial of "ATG9A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
