Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

ATG9A cdna clone

ATG9A cDNA Clone

Gene Names
ATG9A; mATG9; APG9L1; MGD3208
Synonyms
ATG9A; ATG9A cDNA Clone; ATG9A cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggtgaaccacagtcttcaccctactgaacccgtcaaggtcactctgccagacgcctttttgcctgctcaagtctgtagtgccaggattcaggaaaatggctcccttatcaccatcctggtcattgctggtgtcttctggatccaccggcttatcaagttcatctataacatttgctgctactgggagatccactccttctacctgcacgctctgcgcatccctatgtctgcccttccgtattgcacgtggcaagaagtgcaggcccggatcgtgcagacgcagaaggagcaccagatctgcatccacaaacgtgagctgacagaactggacatctaccaccgcatcctccgtttccagaactacatggtggcactggttaacaaatccctcctgcctctgcgcttccgcctgcctggcctcggggaagctgtcttcttcacccgtggtctcaagtacaactttgagctgatcctcttctggggacctggctctctgtttctcaatgaatggagcctcaaggccgagtacaaacgtggggggcaacggctagagctggcccagcgcctcagcaaccgcatcctgtggattggcatcgctaacttcctgctgtgccccctcatcctcatatggcaaatcctctatgccttcttcagctatgctgaggtgctgaagcgggagccgggggccctgggagcacgctgctggtcactctatggccgctgctacctccgccacttcaacgagctggagcacgagctgcagtcccgcctcaaccgtggctacaagcccgcctccaagtacatgaattgcttcttgtcacctcttttgacactgctggccaagaatggagccttcttcgctggctccatcctggctgtgcttattgccctcaccatttatgacgaagatgtgttggctgtggaacatgtgctgaccaccgtcacactcctgggggtcaccgtgaccgtgtgcaggtcctttatcccggaccagcacatggtgttctgccctgagcagctgctccgcgtgatcctcgctcacatccactacatgcctgaccactggcagggtaatgcccaccgctcgcagacccgggacgagtttgcccagctcttccagtacaaggcagtgttcattttggaagagttgctgagccccattgtcacacccctcatcctcatcttctgcctgcgcccacgggccctggagattatagacttcttccgaaacttcaccgtggaggtcgttggtgtgggagatacctgctcctttgctcagatggatgttcgccagcatggtcatccccagtggctatctgctgggcagacagaggcctcagtgtaccagcaagctgaggatggaaagacagagttgtcactcatgcactttgccatcaccaaccctggctggcagccaccacgtgagagcacagccttcctaggcttcctcaaggagcaggttcagcgggatggagcagctgctagcctcgccaagggggtctgctccctgaaaatgccctctttacgtctatccagtccttacaatctgagtctgagcccctga
Sequence Length
1566
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,694 Da
NCBI Official Full Name
Homo sapiens ATG9 autophagy related 9 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 9A
NCBI Official Symbol
ATG9A
NCBI Official Synonym Symbols
mATG9; APG9L1; MGD3208
NCBI Protein Information
autophagy-related protein 9A
UniProt Protein Name
Autophagy-related protein 9A
Protein Family
UniProt Gene Name
ATG9A
UniProt Synonym Gene Names
APG9L1
UniProt Entry Name
ATG9A_HUMAN

Uniprot Description

ATG9A: Plays a role in autophagy. Cycles between a juxta- nuclear trans-Golgi network compartment and late endosomes. Nutrient starvation induces accumulation on autophagosomes. Starvation-dependent trafficking requires ULK1, ATG13 and FAM48A. Interacts with FAM48A. Belongs to the ATG9 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Membrane protein, multi-pass; Autophagy; Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: endosome; late endosome; membrane; recycling endosome; trans-Golgi network

Molecular Function: protein binding

Biological Process: autophagic vacuole formation; mitochondrion degradation

Research Articles on ATG9A

1. Importantly, TBC1D14 and TRAPPIII regulate ATG9 trafficking independently of ULK1.

Similar Products

ATG9A Antibody

Host: n/a
Reactivity: n/a
Apps: n/a

Atg9a Antibody

Host: Rabbit
Reactivity: Human, Mouse, Rat
Apps: Western Blot

ATG9A ELISA Kit

Host: n/a
Reactivity: Human
Apps: n/a

ATG9A Antibody

Host: Rabbit
Reactivity: Human, Mouse, Rat
Apps: ELISA, Immunohistochemistry

Product Notes

The ATG9A atg9a (Catalog #AAA1266487) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaacc acagtcttca ccctactgaa cccgtcaagg tcactctgcc agacgccttt ttgcctgctc aagtctgtag tgccaggatt caggaaaatg gctcccttat caccatcctg gtcattgctg gtgtcttctg gatccaccgg cttatcaagt tcatctataa catttgctgc tactgggaga tccactcctt ctacctgcac gctctgcgca tccctatgtc tgcccttccg tattgcacgt ggcaagaagt gcaggcccgg atcgtgcaga cgcagaagga gcaccagatc tgcatccaca aacgtgagct gacagaactg gacatctacc accgcatcct ccgtttccag aactacatgg tggcactggt taacaaatcc ctcctgcctc tgcgcttccg cctgcctggc ctcggggaag ctgtcttctt cacccgtggt ctcaagtaca actttgagct gatcctcttc tggggacctg gctctctgtt tctcaatgaa tggagcctca aggccgagta caaacgtggg gggcaacggc tagagctggc ccagcgcctc agcaaccgca tcctgtggat tggcatcgct aacttcctgc tgtgccccct catcctcata tggcaaatcc tctatgcctt cttcagctat gctgaggtgc tgaagcggga gccgggggcc ctgggagcac gctgctggtc actctatggc cgctgctacc tccgccactt caacgagctg gagcacgagc tgcagtcccg cctcaaccgt ggctacaagc ccgcctccaa gtacatgaat tgcttcttgt cacctctttt gacactgctg gccaagaatg gagccttctt cgctggctcc atcctggctg tgcttattgc cctcaccatt tatgacgaag atgtgttggc tgtggaacat gtgctgacca ccgtcacact cctgggggtc accgtgaccg tgtgcaggtc ctttatcccg gaccagcaca tggtgttctg ccctgagcag ctgctccgcg tgatcctcgc tcacatccac tacatgcctg accactggca gggtaatgcc caccgctcgc agacccggga cgagtttgcc cagctcttcc agtacaaggc agtgttcatt ttggaagagt tgctgagccc cattgtcaca cccctcatcc tcatcttctg cctgcgccca cgggccctgg agattataga cttcttccga aacttcaccg tggaggtcgt tggtgtggga gatacctgct cctttgctca gatggatgtt cgccagcatg gtcatcccca gtggctatct gctgggcaga cagaggcctc agtgtaccag caagctgagg atggaaagac agagttgtca ctcatgcact ttgccatcac caaccctggc tggcagccac cacgtgagag cacagccttc ctaggcttcc tcaaggagca ggttcagcgg gatggagcag ctgctagcct cgccaagggg gtctgctccc tgaaaatgcc ctctttacgt ctatccagtc cttacaatct gagtctgagc ccctga. It is sometimes possible for the material contained within the vial of "ATG9A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

aaabiotech.com © 2012-2025

All rights reserved.

Contact us by

Tel: +1 (619) 604-9440 | Fax: +1 (619) 604-9440
contact@aaabiotech.com
Looking for a specific manual?
Request a Manual