ATG2B cdna clone
ATG2B cDNA Clone
Gene Names
ATG2B; C14orf103
Synonyms
ATG2B; ATG2B cDNA Clone; ATG2B cdna clone
Sequence
atgaatctcattcagtacattgcaagctatggtgacttgcagacacctaacaaggcagatatgaagcctggagcctttcaaagaaggtctaaggtagattccagtggtcgatcatcctcacgtggtccagtacttcctgaagcagatcaacaaatgttacgagatctgatgagtgatgctatggaggagatcgacatgcaacaaggcacctcgtcagtaaaaccacaggctaatggtgttttggatgaaaaatctcaaattcaggagccatgttgttcagacctcttcctgtttcctgacgagagtgggaatgtatcccaggagtccggccccacctatgcctcattctctcaccatttcatcagtgatgcaatgacaggtgtgcccactgagaatgatgacttttgcattctttttgcaccaaaagcagccatgcaggagaaggaagaagaaccagttataaaaatcatggttgatgatgcaattgtgataagagacaattatttcagtctgcccgttaataagaccgatacgagcaaagcccccttacactttcccattcctgtgattcgctatgtggtgaaggaggtctctcttgtctggcatctttatggaggaaaggattttggaacagtccctcccacttctccggctaaaagttatattagtccccacagttcgccttctcacacacccacgagacatggacgtaatacagtatgtgggggaaaaggaaggaaccatgactttttaatggaaatacagctaagcaaggtgaagtttcagcatgaagtctacccgccatgcaaacctgattgtgattccagcctctcagaacacccagtctcccggcaggtgttcattgttcaggatcttgagattcgagatcgtttggcaacatcacaaatgaataaatttttatacctgtattgcagtaaagaaatgcctcgaaaagctcactccaacatgttgacagtgaaagccttacacgtgtgtccagaatctggcaggtccccacaggagtgctgcttgagagtgtcgctgatgccgctccgcctcaatattgaccaggatgctttgttcttcctgaaggatttcttcacaagtctttctgcagaagtagagcttcaaatgactccagatccagaagttaaaaagtctcctggagctgatgtcacctgcagtttgccaaggcatttgagtacctcaaaggagccaaatctggttatttctttctctgggccaaaacagccttcccaaaatgatagtgccaattcagtggaagtggttaatggcatggaagagaagaacttctctgctgaagaagcatcttttagggatcagcctgtgttttttagagaatttagattcacgtcagaagttcccattcgacttgattatcatggcaaacatgtatcaatggatcagggtacgctagctgggattttgattggtctggctcagttaaactgctctgaactaaagctcaagaggctttcctatcgacatggtttactaggcgttgacaaattattctcatatgcaatcactgagtggcttaatgacattaagaagaaccagctaccaggaatcctgggaggtgttggacctatgcattcactagtacaattagtacaaggcctaaaggacttggtctggctcccaatagagcagtaccggaaggatggccgcattgtcagagggtttcagagaggcgctgcttcctttggtacctcgacagcgatggctgctctagaactcacaaacagaatggttcaaaccatacaggcagctgcagagactgcttatgatatggtgtctcctggtaccctttctatcgagcccaagaagaccaaaaggtttcctcatcaccggttagcccaccagccagtagacctgagggaaggtgtggccaaggcctacagtgttgtgaaagagggaatcacagacacggctcagaccatttatgaaactgcggctcgagaacacgagagcagaggggtgactggtgccgtgggcgaggttctgcgccagattcctccggcagtggtgaaacctctgattgttgccacagaagcaacgtcaaacgtgctgggtggcatgagaaaccaaattaggccagatgtccggcaagacgagtcacagaaatggcgccacggggatgactga
Sequence Length
2169
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
232,763 Da
NCBI Official Full Name
Homo sapiens ATG2 autophagy related 2 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 2B
NCBI Official Symbol
ATG2B
NCBI Official Synonym Symbols
C14orf103
NCBI Protein Information
autophagy-related protein 2 homolog B
UniProt Protein Name
Autophagy-related protein 2 homolog B
Protein Family
UniProt Gene Name
ATG2B
UniProt Synonym Gene Names
C14orf103
UniProt Entry Name
ATG2B_HUMAN
NCBI Description
This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Uniprot Description
ATG2B: Required for both autophagosome formation and regulation of lipid droplet morphology and dispersion. Belongs to the ATG2 family.
Protein type: Autophagy
Chromosomal Location of Human Ortholog: 14q32.2
Cellular Component: extrinsic to membrane
Biological Process: autophagic vacuole formation; mitochondrion degradation
Research Articles on ATG2B
Similar Products
Product Notes
The ATG2B atg2b (Catalog #AAA1278869) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatctca ttcagtacat tgcaagctat ggtgacttgc agacacctaa caaggcagat atgaagcctg gagcctttca aagaaggtct aaggtagatt ccagtggtcg atcatcctca cgtggtccag tacttcctga agcagatcaa caaatgttac gagatctgat gagtgatgct atggaggaga tcgacatgca acaaggcacc tcgtcagtaa aaccacaggc taatggtgtt ttggatgaaa aatctcaaat tcaggagcca tgttgttcag acctcttcct gtttcctgac gagagtggga atgtatccca ggagtccggc cccacctatg cctcattctc tcaccatttc atcagtgatg caatgacagg tgtgcccact gagaatgatg acttttgcat tctttttgca ccaaaagcag ccatgcagga gaaggaagaa gaaccagtta taaaaatcat ggttgatgat gcaattgtga taagagacaa ttatttcagt ctgcccgtta ataagaccga tacgagcaaa gcccccttac actttcccat tcctgtgatt cgctatgtgg tgaaggaggt ctctcttgtc tggcatcttt atggaggaaa ggattttgga acagtccctc ccacttctcc ggctaaaagt tatattagtc cccacagttc gccttctcac acacccacga gacatggacg taatacagta tgtgggggaa aaggaaggaa ccatgacttt ttaatggaaa tacagctaag caaggtgaag tttcagcatg aagtctaccc gccatgcaaa cctgattgtg attccagcct ctcagaacac ccagtctccc ggcaggtgtt cattgttcag gatcttgaga ttcgagatcg tttggcaaca tcacaaatga ataaattttt atacctgtat tgcagtaaag aaatgcctcg aaaagctcac tccaacatgt tgacagtgaa agccttacac gtgtgtccag aatctggcag gtccccacag gagtgctgct tgagagtgtc gctgatgccg ctccgcctca atattgacca ggatgctttg ttcttcctga aggatttctt cacaagtctt tctgcagaag tagagcttca aatgactcca gatccagaag ttaaaaagtc tcctggagct gatgtcacct gcagtttgcc aaggcatttg agtacctcaa aggagccaaa tctggttatt tctttctctg ggccaaaaca gccttcccaa aatgatagtg ccaattcagt ggaagtggtt aatggcatgg aagagaagaa cttctctgct gaagaagcat cttttaggga tcagcctgtg ttttttagag aatttagatt cacgtcagaa gttcccattc gacttgatta tcatggcaaa catgtatcaa tggatcaggg tacgctagct gggattttga ttggtctggc tcagttaaac tgctctgaac taaagctcaa gaggctttcc tatcgacatg gtttactagg cgttgacaaa ttattctcat atgcaatcac tgagtggctt aatgacatta agaagaacca gctaccagga atcctgggag gtgttggacc tatgcattca ctagtacaat tagtacaagg cctaaaggac ttggtctggc tcccaataga gcagtaccgg aaggatggcc gcattgtcag agggtttcag agaggcgctg cttcctttgg tacctcgaca gcgatggctg ctctagaact cacaaacaga atggttcaaa ccatacaggc agctgcagag actgcttatg atatggtgtc tcctggtacc ctttctatcg agcccaagaa gaccaaaagg tttcctcatc accggttagc ccaccagcca gtagacctga gggaaggtgt ggccaaggcc tacagtgttg tgaaagaggg aatcacagac acggctcaga ccatttatga aactgcggct cgagaacacg agagcagagg ggtgactggt gccgtgggcg aggttctgcg ccagattcct ccggcagtgg tgaaacctct gattgttgcc acagaagcaa cgtcaaacgt gctgggtggc atgagaaacc aaattaggcc agatgtccgg caagacgagt cacagaaatg gcgccacggg gatgactga. It is sometimes possible for the material contained within the vial of "ATG2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
