Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATG12 cdna clone

ATG12 cDNA Clone

Gene Names
ATG12; APG12; FBR93; APG12L; HAPG12
Synonyms
ATG12; ATG12 cDNA Clone; ATG12 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaggagccgcagtctgtgttgcagcttcctacttcaattgctgctggaggggaaggacttacggatgtctccccagaaacaaccaccccggagcccccgtcttccgctgcagtttccccgggaacagaggaacctgctggcgacaccaagaaaaaaattgacattttgctaaaggctgtgggagacactcctattatgaaaacaaagaagtgggcagtagagcgaacacgaaccatccaaggactcattgacttcatcaaaaagtttcttaaacttgtggcctcagaacagttgtttatttatgtgaatcagtcctttgctccttccccagaccaagaagttggaactctctatgagtgttttggcagtgatggtaaactggttttacattactgcaagtctcaggcgtggggatga
Sequence Length
423
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,746 Da
NCBI Official Full Name
Homo sapiens ATG12 autophagy related 12 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
autophagy related 12
NCBI Official Symbol
ATG12
NCBI Official Synonym Symbols
APG12; FBR93; APG12L; HAPG12
NCBI Protein Information
ubiquitin-like protein ATG12
UniProt Protein Name
Ubiquitin-like protein ATG12
Protein Family
UniProt Gene Name
ATG12
UniProt Synonym Gene Names
APG12; APG12L; APG12-like
UniProt Entry Name
ATG12_HUMAN

NCBI Description

Autophagy is a process of bulk protein degradation in which cytoplasmic components, including organelles, are enclosed in double-membrane structures called autophagosomes and delivered to lysosomes or vacuoles for degradation. ATG12 is the human homolog of a yeast protein involved in autophagy (Mizushima et al., 1998 [PubMed 9852036]).[supplied by OMIM, Mar 2008]

Uniprot Description

ATG12: Ubiquitin-like protein required for autophagy. Conjugated to ATG3 and ATG5. Ubiquitous. Belongs to the ATG12 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin-like modifier; Autophagy

Chromosomal Location of Human Ortholog: 5q21-q22

Cellular Component: cytosol; phagocytic vesicle membrane; pre-autophagosomal structure membrane

Molecular Function: APG8 conjugating enzyme activity; protein binding

Biological Process: autophagic vacuole formation; C-terminal protein lipidation; macroautophagy; mitochondrion degradation

Research Articles on ATG12

Similar Products

Product Notes

The ATG12 atg12 (Catalog #AAA1267491) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg agccgcagtc tgtgttgcag cttcctactt caattgctgc tggaggggaa ggacttacgg atgtctcccc agaaacaacc accccggagc ccccgtcttc cgctgcagtt tccccgggaa cagaggaacc tgctggcgac accaagaaaa aaattgacat tttgctaaag gctgtgggag acactcctat tatgaaaaca aagaagtggg cagtagagcg aacacgaacc atccaaggac tcattgactt catcaaaaag tttcttaaac ttgtggcctc agaacagttg tttatttatg tgaatcagtc ctttgctcct tccccagacc aagaagttgg aactctctat gagtgttttg gcagtgatgg taaactggtt ttacattact gcaagtctca ggcgtgggga tga. It is sometimes possible for the material contained within the vial of "ATG12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.