ASB5 cdna clone
ASB5 cDNA Clone
Gene Names
ASB5; ASB-5
Synonyms
ASB5; ASB5 cDNA Clone; ASB5 cdna clone
Sequence
atgtcggtgttagaagaaaatcggccgtttgctcaacaattatccaatgtctactttacaatactttcgctgttctgttttaagctttttgtgaaaatcagccttgccatcctcagtcatttctacatagtgaaaggcaaccgcaaggaagcggcaaggatagcagctgaattttatggagtaacccaaggacaaggttcctgggcagatcgatcaccactacatgaagcagcaagtcaaggtcgccttcttgctctgagaacattattatcacagggttataatgtaaatgcagtaaccttagaccatgtcaccccattgcacgaagcctgccttggagatcacgtggcatgtgccagaactctgctggaagcaggagctaatgtaaatgcaatcacgatagatggcgtgactccgttattcaacgcatgctcccaaggcagtccaagctgtgcagagctgcttctggagtatggtgccaaagcccagctggagtcatgtcttccatccccaacgcatgaggccgccagtaaaggtcaccatgaatgtcttgacatcctgatatcctggggcatagatgttgaccaagaaattcctcatttgggaactcctctctatgtagcttgtatgtcacagcaattccattgcatctggaagcttctttatgctggtgctgacgtacagaaaggcaaatattgggatactccattacatgctgctgctcaacaatccagcacagaaattgtaaacttactgctagaatttggagcagatatcaatgccaaaaatacagagcttctgcgacctatagatgtagctacgtctagcagtatggtggaaagaatattgcttcaacatgaagctaccccaagctctctttaccaactttgccgactctgtatccgaagctacataggaaaaccaagattgcaccttatcccacaactccagctgccaacgttactgaagaatttcttacagtatcgataa
Sequence Length
990
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,083 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 5, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 5
NCBI Official Symbol
ASB5
NCBI Official Synonym Symbols
ASB-5
NCBI Protein Information
ankyrin repeat and SOCS box protein 5
UniProt Protein Name
Ankyrin repeat and SOCS box protein 5
Protein Family
UniProt Gene Name
ASB5
UniProt Synonym Gene Names
ASB-5
UniProt Entry Name
ASB5_HUMAN
NCBI Description
The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but their full length sequences are not known. [provided by RefSeq, Jul 2008]
Uniprot Description
ASB5: May be a substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. May play a role in the initiation of arteriogenesis.
Chromosomal Location of Human Ortholog: 4q34.2
Research Articles on ASB5
Similar Products
Product Notes
The ASB5 asb5 (Catalog #AAA1268145) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtgt tagaagaaaa tcggccgttt gctcaacaat tatccaatgt ctactttaca atactttcgc tgttctgttt taagcttttt gtgaaaatca gccttgccat cctcagtcat ttctacatag tgaaaggcaa ccgcaaggaa gcggcaagga tagcagctga attttatgga gtaacccaag gacaaggttc ctgggcagat cgatcaccac tacatgaagc agcaagtcaa ggtcgccttc ttgctctgag aacattatta tcacagggtt ataatgtaaa tgcagtaacc ttagaccatg tcaccccatt gcacgaagcc tgccttggag atcacgtggc atgtgccaga actctgctgg aagcaggagc taatgtaaat gcaatcacga tagatggcgt gactccgtta ttcaacgcat gctcccaagg cagtccaagc tgtgcagagc tgcttctgga gtatggtgcc aaagcccagc tggagtcatg tcttccatcc ccaacgcatg aggccgccag taaaggtcac catgaatgtc ttgacatcct gatatcctgg ggcatagatg ttgaccaaga aattcctcat ttgggaactc ctctctatgt agcttgtatg tcacagcaat tccattgcat ctggaagctt ctttatgctg gtgctgacgt acagaaaggc aaatattggg atactccatt acatgctgct gctcaacaat ccagcacaga aattgtaaac ttactgctag aatttggagc agatatcaat gccaaaaata cagagcttct gcgacctata gatgtagcta cgtctagcag tatggtggaa agaatattgc ttcaacatga agctacccca agctctcttt accaactttg ccgactctgt atccgaagct acataggaaa accaagattg caccttatcc cacaactcca gctgccaacg ttactgaaga atttcttaca gtatcgataa. It is sometimes possible for the material contained within the vial of "ASB5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
