Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASB2 cdna clone

ASB2 cDNA Clone

Gene Names
ASB2; ASB-2
Synonyms
ASB2; ASB2 cDNA Clone; ASB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacccgcttctcctatgcagagtacttttccctctttcactcctgctctgcaccctccaggtccactgcacctcctgagagttcgccggcccgggccccaatgggcttgttccaaggggtcatgcagaaatacagcagcagcttgttcaagacctcccagctggcgcctgcggaccccttgataaaggccatcaaggatggcgatgaagaggccttgaagaccatgatcaaggaagggaagaatctcgcagagcccaacaaggagggctggctgccgctgcacgaggccgcatactatggccaggtgggctgcctgaaagtcctgcagcgagcgtacccagggaccatcgaccagcgcaccctgcaggaggaaacagccgtttacttggcaacgtgcaggggccacctggactgtctcctgtcactgctccaagcaggggcagagccggacatctccaacaaatcccgagagacaccgctctacaaagcctgcgagcgcaagaacgcggaggccgtgaagattctggtgcagcacaacgcagacaccaaccaccgctgcaaccgcggctggaccgctctgcacgagtctgtgtctcgcaatgacctggaggtcatgcagatcctggtgagcggaggagccaaggtggaatccaagaacgcctacggcatcacccccttgttcgtggccgcccagagtggacagttggaggccttgaggttcttagccaagtacggtgctgacatcaacacgcaggccagcgacaacgcgtctgccctctacgaggcctgcaagaatgagcatgaggaggtggtggagtttctgctgtcacagggtgccgacgccaacaagaccaacaaggacggcttgctcccgctgcacatcgcctccaagaagggcaactacaggatcgtgcagatgctgctgccggtgaccagccgcacgcgcatacgccgtagcggcgtcagtccgctgcacctggcggccgagcgcaaccacgacgaggtgctggaggcgctgctgagcgcgcgcttcgacgtgaacacgccgctggcgcccgagcgcgcgcgcctctacgaagaccggcgcagctccgcgctgtacttcgcggtggtcaacaacaacgtgtacgccaccgagctgctgctgcaacacggcgccgaccccaaccgcgacgtcatcagccccttgctcgtggccatccgccacggctgcctgcgcacaatgcagctgctgctggaccacggcgcgaacatcgacgcctatatcgccacgcaccccaccgccttccccgccaccatcatgttcgccatgaagtgcctgtcgctgctcaagttcctcatggacctgggctgcgacggcgagccctgcttctcatgcctctacggcaacggcccgcacccgccggccccgcagccctccagcaggttcaacgacgcgcccgcggccgacaaggagcccagcgtggtgcagttctgtgagttcgtatctgccccagaggtgagccgctgggcggggcccatcatcgatgtcctcctggactacgtgggcaacgtgcagctctgctcgcggctgaaggaacacatcgacagctttgaggactgggccgtcatcaaggagaaggcagaacctccaagacctctggctcacctttgccgactgcgggttcgaaaggccattgggaaataccgtataaaactcctagacaccttgccgctcccaggcaggctgattagatacctgaaatacgagaacacccagtaa
Sequence Length
1764
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,212 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 2, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 2
NCBI Official Symbol
ASB2
NCBI Official Synonym Symbols
ASB-2
NCBI Protein Information
ankyrin repeat and SOCS box protein 2
UniProt Protein Name
Ankyrin repeat and SOCS box protein 2
Protein Family
UniProt Gene Name
ASB2
UniProt Synonym Gene Names
ASB-2
UniProt Entry Name
ASB2_HUMAN

NCBI Description

This gene encodes a member of the ankyrin repeat and SOCS box-containing (ASB) protein family. These proteins play a role in protein degradation by coupling suppressor of cytokine signalling (SOCS) proteins with the elongin BC complex. The encoded protein is a subunit of a multimeric E3 ubiquitin ligase complex that mediates the degradation of actin-binding proteins. This gene plays a role in retinoic acid-induced growth inhibition and differentiation of myeloid leukemia cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

ASB2: Probable substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 14q31-q32

Molecular Function: protein binding

Biological Process: positive regulation of defense response to virus by host; signal transduction

Research Articles on ASB2

Similar Products

Product Notes

The ASB2 asb2 (Catalog #AAA1278579) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacccgct tctcctatgc agagtacttt tccctctttc actcctgctc tgcaccctcc aggtccactg cacctcctga gagttcgccg gcccgggccc caatgggctt gttccaaggg gtcatgcaga aatacagcag cagcttgttc aagacctccc agctggcgcc tgcggacccc ttgataaagg ccatcaagga tggcgatgaa gaggccttga agaccatgat caaggaaggg aagaatctcg cagagcccaa caaggagggc tggctgccgc tgcacgaggc cgcatactat ggccaggtgg gctgcctgaa agtcctgcag cgagcgtacc cagggaccat cgaccagcgc accctgcagg aggaaacagc cgtttacttg gcaacgtgca ggggccacct ggactgtctc ctgtcactgc tccaagcagg ggcagagccg gacatctcca acaaatcccg agagacaccg ctctacaaag cctgcgagcg caagaacgcg gaggccgtga agattctggt gcagcacaac gcagacacca accaccgctg caaccgcggc tggaccgctc tgcacgagtc tgtgtctcgc aatgacctgg aggtcatgca gatcctggtg agcggaggag ccaaggtgga atccaagaac gcctacggca tcaccccctt gttcgtggcc gcccagagtg gacagttgga ggccttgagg ttcttagcca agtacggtgc tgacatcaac acgcaggcca gcgacaacgc gtctgccctc tacgaggcct gcaagaatga gcatgaggag gtggtggagt ttctgctgtc acagggtgcc gacgccaaca agaccaacaa ggacggcttg ctcccgctgc acatcgcctc caagaagggc aactacagga tcgtgcagat gctgctgccg gtgaccagcc gcacgcgcat acgccgtagc ggcgtcagtc cgctgcacct ggcggccgag cgcaaccacg acgaggtgct ggaggcgctg ctgagcgcgc gcttcgacgt gaacacgccg ctggcgcccg agcgcgcgcg cctctacgaa gaccggcgca gctccgcgct gtacttcgcg gtggtcaaca acaacgtgta cgccaccgag ctgctgctgc aacacggcgc cgaccccaac cgcgacgtca tcagcccctt gctcgtggcc atccgccacg gctgcctgcg cacaatgcag ctgctgctgg accacggcgc gaacatcgac gcctatatcg ccacgcaccc caccgccttc cccgccacca tcatgttcgc catgaagtgc ctgtcgctgc tcaagttcct catggacctg ggctgcgacg gcgagccctg cttctcatgc ctctacggca acggcccgca cccgccggcc ccgcagccct ccagcaggtt caacgacgcg cccgcggccg acaaggagcc cagcgtggtg cagttctgtg agttcgtatc tgccccagag gtgagccgct gggcggggcc catcatcgat gtcctcctgg actacgtggg caacgtgcag ctctgctcgc ggctgaagga acacatcgac agctttgagg actgggccgt catcaaggag aaggcagaac ctccaagacc tctggctcac ctttgccgac tgcgggttcg aaaggccatt gggaaatacc gtataaaact cctagacacc ttgccgctcc caggcaggct gattagatac ctgaaatacg agaacaccca gtaa. It is sometimes possible for the material contained within the vial of "ASB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.