Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASB17 cdna clone

ASB17 cDNA Clone

Gene Names
ASB17; Asb-17
Synonyms
ASB17; ASB17 cDNA Clone; ASB17 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtaaatctactaaattatgtggtaagacttcttgtccaagaagcaatatattctgcaatctccttgacaaaattgttaaaagaccctccctacagtttttgggtcagtggggatatcactgttacgaaccaaggatttacagatcactggcaaaaattctgaggtatgtggacttggatggttttgacgcactactcacagattacattgcatttgtggaaaaatcaggataccgttttgaagtaagttttaacctcgacttcactgaaatatgtgtgaatacaattctgtactgggtttttgccagaaaaggtaatcctgactttgtggaattgcttctcaagaagacaaaagactatgttcaagacagaagttgtaacctggcactgatatggagaactttcacaccagtatactgtccaagcccattaagtggcatcacacctctcttttatgtagctcagacaagacagtctaatatcttcaaaatactactgcaatatggaatcttagaaagagaaaaaaaccctatcaacattgtcttaacaatagtactctacccttcgagagtaagagtaatggttgatcgtgaattggctgacatccatgaagatgccaaaacatgtttggtactatgttccagagtgctttctgtcatttcagtcaaggaaataaagacacagctgagtttaggaagacatccaattatttcaaattggtttgattacattccttcaacaagatacaaagatccatgtgaactattacatctttgcagactaaccatcaggaatcaactattaaccaacaatatgctcccagatggaatattttcacttctaattcctgctcgtctacaaaactatctgaatttagaaatctaa
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,282 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 17, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 17
NCBI Official Symbol
ASB17
NCBI Official Synonym Symbols
Asb-17
NCBI Protein Information
ankyrin repeat and SOCS box protein 17
UniProt Protein Name
Ankyrin repeat and SOCS box protein 17
UniProt Gene Name
ASB17
UniProt Synonym Gene Names
ASB-17
UniProt Entry Name
ASB17_HUMAN

Uniprot Description

ASB17: May be a substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.

Chromosomal Location of Human Ortholog: 1p31.1

Research Articles on ASB17

Similar Products

Product Notes

The ASB17 asb17 (Catalog #AAA1269644) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtaaat ctactaaatt atgtggtaag acttcttgtc caagaagcaa tatattctgc aatctccttg acaaaattgt taaaagaccc tccctacagt ttttgggtca gtggggatat cactgttacg aaccaaggat ttacagatca ctggcaaaaa ttctgaggta tgtggacttg gatggttttg acgcactact cacagattac attgcatttg tggaaaaatc aggataccgt tttgaagtaa gttttaacct cgacttcact gaaatatgtg tgaatacaat tctgtactgg gtttttgcca gaaaaggtaa tcctgacttt gtggaattgc ttctcaagaa gacaaaagac tatgttcaag acagaagttg taacctggca ctgatatgga gaactttcac accagtatac tgtccaagcc cattaagtgg catcacacct ctcttttatg tagctcagac aagacagtct aatatcttca aaatactact gcaatatgga atcttagaaa gagaaaaaaa ccctatcaac attgtcttaa caatagtact ctacccttcg agagtaagag taatggttga tcgtgaattg gctgacatcc atgaagatgc caaaacatgt ttggtactat gttccagagt gctttctgtc atttcagtca aggaaataaa gacacagctg agtttaggaa gacatccaat tatttcaaat tggtttgatt acattccttc aacaagatac aaagatccat gtgaactatt acatctttgc agactaacca tcaggaatca actattaacc aacaatatgc tcccagatgg aatattttca cttctaattc ctgctcgtct acaaaactat ctgaatttag aaatctaa. It is sometimes possible for the material contained within the vial of "ASB17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.