Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASB14 cdna clone

ASB14 cDNA Clone

Synonyms
ASB14; ASB14 cDNA Clone; ASB14 cdna clone
Ordering
For Research Use Only!
Sequence
ATGTTGAAATGCATTTTGAAATTCTTTCTCAGAGCTCTAAAGATACTGATTCCAGTTACGGATCTTGCTGCCATTAAGCAGAGTGGGATCAGTCCAGTTCACTGTGCAGCAGCAGGAGCACATCCTCAGTGCCTGGAACTCCTCATCCAGGCTGGATTTGATGTGAACTTCATGCTGGATCAGAGAATTAACAAACACTACGATGACCACAGGAAGTCAGCTTTGTATTTTGCTGTATCAAACAGTGACCTCTCTTCAGTCAAGCTGCTTCTGAGTGCTGGAGCTCTGCCTAATCAAGACCCGGTTAACTGCCTCCAGATAGCCCTCAGGATGGGCAACTATGAGCTGATCAGTCTGCTGCTAAGGCATGGGGCCAATGTCAATTACTTCTGCAGAGTTAACCCTTTACATTTCCCATCAGCACTGCAATACACTCTGAAAGATGAAGTCATGCTCAGGATGCTGCTGAACTATGGGTATGACACAGAGCGATGTTTTGATTGCCCACATGGAGACAAAGTCCATCCTTCCTATACTGTTGAAGGCTGGACATCTACAGTTATCAAAGATACTAAGGTAAGTCCACAGTATTGGCTGTATTCCCTTACAGTCATTATTTGTGGCCCTGGAACTATGGCAATAAATAGATTACATCCACTCTCTCCAGAGGCTTGGTTGAAGAGATCCTAG
Sequence Length
690
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,206 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 14, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 14
NCBI Official Symbol
ASB14
NCBI Protein Information
ankyrin repeat and SOCS box protein 14
UniProt Protein Name
Ankyrin repeat and SOCS box protein 14
UniProt Gene Name
ASB14
UniProt Synonym Gene Names
ASB-14
UniProt Entry Name
ASB14_HUMAN

NCBI Description

The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2008]

Uniprot Description

ASB14: May be a substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 3p21.1

Cellular Component: cytoplasm; nucleus; ubiquitin ligase complex

Molecular Function: ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Similar Products

Product Notes

The ASB14 asb14 (Catalog #AAA1273487) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTTGAAAT GCATTTTGAA ATTCTTTCTC AGAGCTCTAA AGATACTGAT TCCAGTTACG GATCTTGCTG CCATTAAGCA GAGTGGGATC AGTCCAGTTC ACTGTGCAGC AGCAGGAGCA CATCCTCAGT GCCTGGAACT CCTCATCCAG GCTGGATTTG ATGTGAACTT CATGCTGGAT CAGAGAATTA ACAAACACTA CGATGACCAC AGGAAGTCAG CTTTGTATTT TGCTGTATCA AACAGTGACC TCTCTTCAGT CAAGCTGCTT CTGAGTGCTG GAGCTCTGCC TAATCAAGAC CCGGTTAACT GCCTCCAGAT AGCCCTCAGG ATGGGCAACT ATGAGCTGAT CAGTCTGCTG CTAAGGCATG GGGCCAATGT CAATTACTTC TGCAGAGTTA ACCCTTTACA TTTCCCATCA GCACTGCAAT ACACTCTGAA AGATGAAGTC ATGCTCAGGA TGCTGCTGAA CTATGGGTAT GACACAGAGC GATGTTTTGA TTGCCCACAT GGAGACAAAG TCCATCCTTC CTATACTGTT GAAGGCTGGA CATCTACAGT TATCAAAGAT ACTAAGGTAA GTCCACAGTA TTGGCTGTAT TCCCTTACAG TCATTATTTG TGGCCCTGGA ACTATGGCAA TAAATAGATT ACATCCACTC TCTCCAGAGG CTTGGTTGAA GAGATCCTAG. It is sometimes possible for the material contained within the vial of "ASB14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.