Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGEF15 cdna clone

ARHGEF15 cDNA Clone

Gene Names
ARHGEF15; E5; ARGEF15; Ephexin5; Vsm-RhoGEF
Synonyms
ARHGEF15; ARHGEF15 cDNA Clone; ARHGEF15 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagcccagtcccttcctgcagcaacaccccccacgcagaagccccctcggatcatccgcccccgccctccttctcgttccagggctgcccagtccccagggcctccccacaatggctcctctccacaagaactaccccgaaactccaatgatgcaccaaccccaatgtgcacccccatcttctgggagcccccagctgcatccctcaagccccctgctcttttgcccccctcagcttctagagccagcctcgactcccagacttccccagactcaccttccagcacccccacacctagtccagtgtcccggcgctccgcctccccagaacctgctccccggtctccagtccccccacccaagccgtctgggtcaccctgcacgcctctgctccccatggctggagtcctggctcagaatggctctgcctcagctcctggcactgtgcggaggctggctgtcaggtttgaagggggtgctgaaggccgggctcaggatgcagatgccccggagccaggtctccaagcgagagcagatgtgaatggggagagagaagctcccctcaccgggagtgggtcccaggagaacggtgctccagatgctggcctggcctgccctccctgctgcccctgtgtctgccacaccacccggcctggcctggagctcagatgggtgcctgtggggggctatgaggaggtccccagggtcccccgtcgggcctccccgctgcggacctctcgctcccgcccccaccctccaagcatcggtcaccctgccgttgtcctcacatcctaccgctccactgctgagcgcaaactcctgccacccctcaagcctcccaaaccaactcgtgtcaggcaggatgccaccattttcggggaccccccacagccagatcttgatctgctttctgaagatggaatccaaacaggggacagtcctgatgaagctcctcagaatactcctccagcaactgtggaggggagggaagaggaggggctagaggtgctgaaggagcagaattgggagctgcccctgcaggatgaacctctgtaccagacctaccgagcagccgtgctgtcagaggagctgtggggggtgggtgaggatgggagtccttctccagcaaatgctggagatgcacccaccttcccacgaccccctggacctcgcaacaccctgtggcaggagcttccggctgtgcaagccagcggtcttctggataccctcagcccccaggagaggcgcatgcaggagagtcttttcgaggtggtgacgtccgaggcttcctacctgcgctccctgcggctgctgaccgacaccttcgtgctgagccaggcactccgggacacgctcaccccccgtgatcaccacacactcttctccaatgtgcagcgagtccagggagtcagcgagcggtttctagcaacgctcctgtcccgtgtgcgctcttccccccacatcagcgacttgtgtgatgtggtgcatgcccacgctgtggggcctttctcggtgtatgtggattatgtgcggaaccagcagtatcaggaggagacctacagccgcctcatggacaccaacgtgcgcttctccgccgagctgcgccggctgcagagcctccctaagtgtgagcggctcccgctgccgtccttcctgctactgcccttccagcgcatcacccggctgcgcatgctgctgcagaatatcctgcgccagacagaagaggggtccagccgtcaggagaatgcccagaaggccctgggtgctgtcagcaagatcatcgagcgttgcagcgctgaggtggggcgcatgaagcagactgaagagctgatccggctcacccaaaggctgcgcttccacaaagtcaaggccctgcccctggtctcctggtcacggcgcctggaattccagggagagctgactgagttagggtgccggagggggggcgtgctctttgcctcgcgcccccgcttcacccctctttgcctgctgctctttagcgacctgctgctcatcactcagcctaagagtgggcagcggttacaggttctggactatgcccatcgctccctggtccaggcccagcaggttccggatccatctggaccccctaccttccgcctctcccttctcagcaaccaccagggccgccccacccaccgactactccaagcttcttccctatcagacatgcagcgctggctgggagccttcccaaccccaggcccccttccctgctccccagacaccatctatgaggactgtgactgttcccaggaactgtgttcagagtcgtctgcacctgccaagactgaaggacggagtctggagtccagggctgcccccaaacacctgcacaagacccctgaaggttggctgaaggggcttcctggggccttccctgcccagctggtgtgtgaagtcacaggggaacacgaaaggaggaggcaccttcgccagaaccagaggcttctcgaggctgttggaccttcttcaggcacccccaatgcccccccaccctaa
Sequence Length
2526
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
91,940 Da
NCBI Official Full Name
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 15, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 15
NCBI Official Symbol
ARHGEF15
NCBI Official Synonym Symbols
E5; ARGEF15; Ephexin5; Vsm-RhoGEF
NCBI Protein Information
rho guanine nucleotide exchange factor 15
UniProt Protein Name
Rho guanine nucleotide exchange factor 15
UniProt Gene Name
ARHGEF15
UniProt Synonym Gene Names
KIAA0915; E5
UniProt Entry Name
ARHGF_HUMAN

NCBI Description

Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein-coupled receptors. This gene encodes a protein that functions as a specific guanine nucleotide exchange factor for RhoA. It also interacts with ephrin A4 in vascular smooth muscle cells. Two alternatively spliced transcripts variants that encode the same protein have been found for this gene. [provided by RefSeq, Aug 2010]

Uniprot Description

ephexin-5: Specific GEF for RhoA activation. Does not activate RAC1 or CDC42. Regulates vascular smooth muscle contractility. Negatively regulates excitatory synapse development by suppressing the synapse-promoting activity of EPHB2.

Protein type: GEFs; GEFs, Rac/Rho

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: cytoplasm; dendrite

Molecular Function: protein binding; Rho guanyl-nucleotide exchange factor activity

Biological Process: positive regulation of stress fiber formation; regulation of catalytic activity

Research Articles on ARHGEF15

Similar Products

Product Notes

The ARHGEF15 arhgef15 (Catalog #AAA1272960) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagccc agtcccttcc tgcagcaaca ccccccacgc agaagccccc tcggatcatc cgcccccgcc ctccttctcg ttccagggct gcccagtccc cagggcctcc ccacaatggc tcctctccac aagaactacc ccgaaactcc aatgatgcac caaccccaat gtgcaccccc atcttctggg agcccccagc tgcatccctc aagccccctg ctcttttgcc cccctcagct tctagagcca gcctcgactc ccagacttcc ccagactcac cttccagcac ccccacacct agtccagtgt cccggcgctc cgcctcccca gaacctgctc cccggtctcc agtcccccca cccaagccgt ctgggtcacc ctgcacgcct ctgctcccca tggctggagt cctggctcag aatggctctg cctcagctcc tggcactgtg cggaggctgg ctgtcaggtt tgaagggggt gctgaaggcc gggctcagga tgcagatgcc ccggagccag gtctccaagc gagagcagat gtgaatgggg agagagaagc tcccctcacc gggagtgggt cccaggagaa cggtgctcca gatgctggcc tggcctgccc tccctgctgc ccctgtgtct gccacaccac ccggcctggc ctggagctca gatgggtgcc tgtggggggc tatgaggagg tccccagggt cccccgtcgg gcctccccgc tgcggacctc tcgctcccgc ccccaccctc caagcatcgg tcaccctgcc gttgtcctca catcctaccg ctccactgct gagcgcaaac tcctgccacc cctcaagcct cccaaaccaa ctcgtgtcag gcaggatgcc accattttcg gggacccccc acagccagat cttgatctgc tttctgaaga tggaatccaa acaggggaca gtcctgatga agctcctcag aatactcctc cagcaactgt ggaggggagg gaagaggagg ggctagaggt gctgaaggag cagaattggg agctgcccct gcaggatgaa cctctgtacc agacctaccg agcagccgtg ctgtcagagg agctgtgggg ggtgggtgag gatgggagtc cttctccagc aaatgctgga gatgcaccca ccttcccacg accccctgga cctcgcaaca ccctgtggca ggagcttccg gctgtgcaag ccagcggtct tctggatacc ctcagccccc aggagaggcg catgcaggag agtcttttcg aggtggtgac gtccgaggct tcctacctgc gctccctgcg gctgctgacc gacaccttcg tgctgagcca ggcactccgg gacacgctca ccccccgtga tcaccacaca ctcttctcca atgtgcagcg agtccaggga gtcagcgagc ggtttctagc aacgctcctg tcccgtgtgc gctcttcccc ccacatcagc gacttgtgtg atgtggtgca tgcccacgct gtggggcctt tctcggtgta tgtggattat gtgcggaacc agcagtatca ggaggagacc tacagccgcc tcatggacac caacgtgcgc ttctccgccg agctgcgccg gctgcagagc ctccctaagt gtgagcggct cccgctgccg tccttcctgc tactgccctt ccagcgcatc acccggctgc gcatgctgct gcagaatatc ctgcgccaga cagaagaggg gtccagccgt caggagaatg cccagaaggc cctgggtgct gtcagcaaga tcatcgagcg ttgcagcgct gaggtggggc gcatgaagca gactgaagag ctgatccggc tcacccaaag gctgcgcttc cacaaagtca aggccctgcc cctggtctcc tggtcacggc gcctggaatt ccagggagag ctgactgagt tagggtgccg gagggggggc gtgctctttg cctcgcgccc ccgcttcacc cctctttgcc tgctgctctt tagcgacctg ctgctcatca ctcagcctaa gagtgggcag cggttacagg ttctggacta tgcccatcgc tccctggtcc aggcccagca ggttccggat ccatctggac cccctacctt ccgcctctcc cttctcagca accaccaggg ccgccccacc caccgactac tccaagcttc ttccctatca gacatgcagc gctggctggg agccttccca accccaggcc cccttccctg ctccccagac accatctatg aggactgtga ctgttcccag gaactgtgtt cagagtcgtc tgcacctgcc aagactgaag gacggagtct ggagtccagg gctgccccca aacacctgca caagacccct gaaggttggc tgaaggggct tcctggggcc ttccctgccc agctggtgtg tgaagtcaca ggggaacacg aaaggaggag gcaccttcgc cagaaccaga ggcttctcga ggctgttgga ccttcttcag gcacccccaa tgccccccca ccctaa. It is sometimes possible for the material contained within the vial of "ARHGEF15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.