Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGDIG cdna clone

ARHGDIG cDNA Clone

Gene Names
ARHGDIG; RHOGDI-3
Synonyms
ARHGDIG; ARHGDIG cDNA Clone; ARHGDIG cdna clone
Ordering
For Research Use Only!
Sequence
atgctgggcctggacgcgtgcgagctgggggcgcagctgctggagctgctccggctggcgctgtgcgcccgagtcctcctggctgacaaggagggtgggccgccggcagtggacgaggtgttggatgaggctgtgcccgagtaccgggcgccggggaggaagagcctcttggagatccggcagctggacccggacgacaggagcctggccaagtacaagcgggtgctgctggggcccctgccaccggccgtggacccaagcctgcccaatgtgcaggtgaccaggctgacactcctgtcggaacaggctccggggcccgtcgtcatggatctcacaggggacctggctgttctgaaggaccaggtgtttgtcctgaaggaaggtgttgattacagagtgaagatctccttcaaggtccacagggagattgtcagcggcctcaagtgtctgcaccacacctaccgccggggcctgcgcgtggacaagaccgtctacatggtgggcagctatggcccgagcgcccaggagtatgagtttgtgactccggtggaggaagcgccgaggggtgcgctggtgcggggcccctatctggtggtgtccctcttcaccgacgatgacaggacgcaccacctgtcctgggagtggggtctctgcatctgccaggactggaaggactga
Sequence Length
678
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
398
Molecular Weight
25,098 Da
NCBI Official Full Name
Homo sapiens Rho GDP dissociation inhibitor (GDI) gamma, mRNA
NCBI Official Synonym Full Names
Rho GDP dissociation inhibitor gamma
NCBI Official Symbol
ARHGDIG
NCBI Official Synonym Symbols
RHOGDI-3
NCBI Protein Information
rho GDP-dissociation inhibitor 3
UniProt Protein Name
Rho GDP-dissociation inhibitor 3
UniProt Gene Name
ARHGDIG
UniProt Synonym Gene Names
Rho GDI 3
UniProt Entry Name
GDIR3_HUMAN

NCBI Description

The GDP-dissociation inhibitors (GDIs) play a primary role in modulating the activation of GTPases by inhibiting the exchange of GDP for GTP. See ARHGDIB (MIM 602843).[supplied by OMIM, Nov 2010]

Uniprot Description

RhoGDI gamma: Inhibits GDP/GTP exchange reaction of RhoB. Interacts specifically with the GDP- and GTP-bound forms of post- translationally processed Rhob and Rhog proteins, both of which show a growth-regulated expression in mammalian cells. Stimulates the release of the GDP-bound but not the GTP-bound RhoB protein. Also inhibits the GDP/GTP exchange of RhoB but shows less ability to inhibit the dissociation of prebound GTP. Belongs to the Rho GDI family.

Protein type: Cell adhesion; G protein regulator, misc.; Motility/polarity/chemotaxis; Inhibitor

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytoplasmic membrane-bound vesicle; cytosol

Molecular Function: protein binding

Biological Process: negative regulation of cell adhesion; regulation of small GTPase mediated signal transduction; Rho protein signal transduction

Research Articles on ARHGDIG

Similar Products

Product Notes

The ARHGDIG arhgdig (Catalog #AAA1272062) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggcc tggacgcgtg cgagctgggg gcgcagctgc tggagctgct ccggctggcg ctgtgcgccc gagtcctcct ggctgacaag gagggtgggc cgccggcagt ggacgaggtg ttggatgagg ctgtgcccga gtaccgggcg ccggggagga agagcctctt ggagatccgg cagctggacc cggacgacag gagcctggcc aagtacaagc gggtgctgct ggggcccctg ccaccggccg tggacccaag cctgcccaat gtgcaggtga ccaggctgac actcctgtcg gaacaggctc cggggcccgt cgtcatggat ctcacagggg acctggctgt tctgaaggac caggtgtttg tcctgaagga aggtgttgat tacagagtga agatctcctt caaggtccac agggagattg tcagcggcct caagtgtctg caccacacct accgccgggg cctgcgcgtg gacaagaccg tctacatggt gggcagctat ggcccgagcg cccaggagta tgagtttgtg actccggtgg aggaagcgcc gaggggtgcg ctggtgcggg gcccctatct ggtggtgtcc ctcttcaccg acgatgacag gacgcaccac ctgtcctggg agtggggtct ctgcatctgc caggactgga aggactga. It is sometimes possible for the material contained within the vial of "ARHGDIG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.