APPBP2 cdna clone
APPBP2 cDNA Clone
Gene Names
APPBP2; PAT1; APP-BP2; HS.84084
Synonyms
APPBP2; APPBP2 cDNA Clone; APPBP2 cdna clone
Sequence
atggcggccgtggaactagagtggatcccagagactctctataacaccgccatctccgctgtcgtggacaactacatccgctcccgccgagacatccgctccttgcccgagaacatccagtttgatgtttactacaagctttaccaacagggacgcttatgtcaactgggcagtgaattttgtgaattggaagtttttgctaaagtactgagagctttggataaaagacatttgcttcatcattgttttcaggctttgatggatcatggtgttaaagttgcttcagtcttggcctactcattcagtaggcggtgctcttatatagcagaatcagatgctgcagtaaaggaaaaagccattcaggttggctttgttttaggtggctttctttcagatgcaggctggtacagtgatgctgagaaagtttttctgtcctgccttcagttgtgtactctacacgatgagatgcttcattggtttcgtgcagtagaatgttgtgtgaggttgcttcatgtgcgaaatggaaactgcaaatatcatttgggtgaagaaacatttaaattagctcagacatatatggataaactatcaaaacatggccagcaagcaaataaagctgcactctatggagaactgtgtgcactcctatttgcaaaaagtcactatgatgaggcatacaaatggtgcatcgaggcaatgaaagaaattacagcaggcttaccagtgaaagttgtggtggatgtcttaagacaagcttctaaggcttgtgtagtaaaacgtgaatttaagaaggcagaacagttaattaaacatgcagtgtatttggcacgggatcattttggatccaaacacccaaaatattctgatacactgctagattatgggttctacttactcaatgtagataatatctgtcagtctgttgcaatttatcaggcagcccttgacattagacagtcagtgtttggtggcaaaaatatccacgtagcaacagctcatgaagatttggcctactcttcttatgtccaccagtatagctctgggaaatttgacaatgcactatttcatgcagaaagagctattggtatcattacccacatcctacctgaagatcatcttcttttggcttcttcaaagagggtgaaagcacttattttagaggagattgcaattgattgtcataataaggaaactgaacagaggctgcttcaagaagctcatgatttgcacctgtcttcactccaactagctaaaaaagcttttggggaatttaatgtacagactgcaaaacactatggaaaccttggaagactttatcagtcaatgagaaaatttaaggaagctgaagaaatgcacatcaaagcaattcagattaaagaacaacttcttggtcaagaagattatgaagtagccctttcagtgggacatctggcttctttatataattatgacatgaatcagtatgaaaatgctgagaaactttatttgcgatctatagcaattgggaagaaactttttggtgagggctacagtggactagaatatgattatcgaggtctcattaaactttacaactccattggaaattacgagaaagtgtttgaatatcacaatgttctgtctaactggaaccggttgcgagatcggcaatattcagtgacagatgctcttgaagatgtcagcaccagcccccagtccactgaagaagtggtgcagtccttcctgatttctcagaatgtcgagggaccgagctgctga
Sequence Length
1758
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
66,853 Da
NCBI Official Full Name
Homo sapiens amyloid beta protein (cytoplasmic tail) binding protein 2, mRNA
NCBI Official Synonym Full Names
amyloid beta precursor protein binding protein 2
NCBI Official Symbol
APPBP2
NCBI Official Synonym Symbols
PAT1; APP-BP2; HS.84084
NCBI Protein Information
amyloid protein-binding protein 2
UniProt Protein Name
Amyloid protein-binding protein 2
Protein Family
UniProt Gene Name
APPBP2
UniProt Synonym Gene Names
KIAA0228; PAT1; APP-BP2
UniProt Entry Name
APBP2_HUMAN
NCBI Description
The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Uniprot Description
APPBP2: May play a role in intracellular protein transport. May be involved in the translocation of APP along microtubules toward the cell surface.
Protein type: Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 17q23.2
Cellular Component: cytoplasm; cytoplasmic vesicle membrane; microtubule associated complex
Molecular Function: microtubule motor activity; protein binding
Biological Process: intracellular protein transport; intracellular transport
Research Articles on APPBP2
Similar Products
Product Notes
The APPBP2 appbp2 (Catalog #AAA1267657) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccg tggaactaga gtggatccca gagactctct ataacaccgc catctccgct gtcgtggaca actacatccg ctcccgccga gacatccgct ccttgcccga gaacatccag tttgatgttt actacaagct ttaccaacag ggacgcttat gtcaactggg cagtgaattt tgtgaattgg aagtttttgc taaagtactg agagctttgg ataaaagaca tttgcttcat cattgttttc aggctttgat ggatcatggt gttaaagttg cttcagtctt ggcctactca ttcagtaggc ggtgctctta tatagcagaa tcagatgctg cagtaaagga aaaagccatt caggttggct ttgttttagg tggctttctt tcagatgcag gctggtacag tgatgctgag aaagtttttc tgtcctgcct tcagttgtgt actctacacg atgagatgct tcattggttt cgtgcagtag aatgttgtgt gaggttgctt catgtgcgaa atggaaactg caaatatcat ttgggtgaag aaacatttaa attagctcag acatatatgg ataaactatc aaaacatggc cagcaagcaa ataaagctgc actctatgga gaactgtgtg cactcctatt tgcaaaaagt cactatgatg aggcatacaa atggtgcatc gaggcaatga aagaaattac agcaggctta ccagtgaaag ttgtggtgga tgtcttaaga caagcttcta aggcttgtgt agtaaaacgt gaatttaaga aggcagaaca gttaattaaa catgcagtgt atttggcacg ggatcatttt ggatccaaac acccaaaata ttctgataca ctgctagatt atgggttcta cttactcaat gtagataata tctgtcagtc tgttgcaatt tatcaggcag cccttgacat tagacagtca gtgtttggtg gcaaaaatat ccacgtagca acagctcatg aagatttggc ctactcttct tatgtccacc agtatagctc tgggaaattt gacaatgcac tatttcatgc agaaagagct attggtatca ttacccacat cctacctgaa gatcatcttc ttttggcttc ttcaaagagg gtgaaagcac ttattttaga ggagattgca attgattgtc ataataagga aactgaacag aggctgcttc aagaagctca tgatttgcac ctgtcttcac tccaactagc taaaaaagct tttggggaat ttaatgtaca gactgcaaaa cactatggaa accttggaag actttatcag tcaatgagaa aatttaagga agctgaagaa atgcacatca aagcaattca gattaaagaa caacttcttg gtcaagaaga ttatgaagta gccctttcag tgggacatct ggcttcttta tataattatg acatgaatca gtatgaaaat gctgagaaac tttatttgcg atctatagca attgggaaga aactttttgg tgagggctac agtggactag aatatgatta tcgaggtctc attaaacttt acaactccat tggaaattac gagaaagtgt ttgaatatca caatgttctg tctaactgga accggttgcg agatcggcaa tattcagtga cagatgctct tgaagatgtc agcaccagcc cccagtccac tgaagaagtg gtgcagtcct tcctgatttc tcagaatgtc gagggaccga gctgctga. It is sometimes possible for the material contained within the vial of "APPBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
