Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOBEC3C cdna clone

APOBEC3C cDNA Clone

Gene Names
APOBEC3C; A3C; PBI; ARP5; ARDC2; ARDC4; APOBEC1L; bK150C2.3
Synonyms
APOBEC3C; APOBEC3C cDNA Clone; APOBEC3C cdna clone
Ordering
For Research Use Only!
Sequence
atgaatccacagatcagaaacccgatgaaggcaatgtatccaggcacattctacttccaatttaaaaacctatgggaagccaacgatcgggacgaaacttggctgtgcttcaccgtggaaggtataaagcgccgctcagttgtctcctggaagacgggcgtcttccgaaaccaggtggattctgagacccattgtcatgcagaaaggtgcttcctctcttggttctgcgacgacatactgtctcctaacacaaagtaccaggtcacctggtacacatcttggagcccttgcccagactgtgcaggggaggtggccgagttcctggccaggcacagcaacgtgaatctcaccatcttcaccgcccgcctctactacttccagtatccatgttaccaggaggggctccgcagcctgagtcaggaaggggtcgctgtggagatcatggactatgaagattttaaatattgttgggaaaactttgtgtacaatgataatgagccattcaagccttggaagggattaaaaaccaactttcgacttctgaaaagaaggctacgggagagtctccagtga
Sequence Length
573
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,826 Da
NCBI Official Full Name
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C, mRNA
NCBI Official Synonym Full Names
apolipoprotein B mRNA editing enzyme catalytic subunit 3C
NCBI Official Symbol
APOBEC3C
NCBI Official Synonym Symbols
A3C; PBI; ARP5; ARDC2; ARDC4; APOBEC1L; bK150C2.3
NCBI Protein Information
DNA dC->dU-editing enzyme APOBEC-3C
UniProt Protein Name
DNA dC->dU-editing enzyme APOBEC-3C
Protein Family
UniProt Gene Name
APOBEC3C
UniProt Synonym Gene Names
APOBEC1L; PBI; A3C
UniProt Entry Name
ABC3C_HUMAN

NCBI Description

This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. [provided by RefSeq, Jul 2008]

Uniprot Description

APOBEC3C: Host cellular restriction factor that may have antiviral activities against exogenous and endogenous viruses, as well as retrotransposons. May also play a role in the epigenetic regulation of gene expression through the process of active DNA demethylation. Belongs to the cytidine and deoxycytidylate deaminase family.

Protein type: RNA-binding; EC 3.5.4.-; Hydrolase

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: cytidine deamination; negative regulation of viral genome replication

Research Articles on APOBEC3C

Similar Products

Product Notes

The APOBEC3C apobec3c (Catalog #AAA1267673) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatccac agatcagaaa cccgatgaag gcaatgtatc caggcacatt ctacttccaa tttaaaaacc tatgggaagc caacgatcgg gacgaaactt ggctgtgctt caccgtggaa ggtataaagc gccgctcagt tgtctcctgg aagacgggcg tcttccgaaa ccaggtggat tctgagaccc attgtcatgc agaaaggtgc ttcctctctt ggttctgcga cgacatactg tctcctaaca caaagtacca ggtcacctgg tacacatctt ggagcccttg cccagactgt gcaggggagg tggccgagtt cctggccagg cacagcaacg tgaatctcac catcttcacc gcccgcctct actacttcca gtatccatgt taccaggagg ggctccgcag cctgagtcag gaaggggtcg ctgtggagat catggactat gaagatttta aatattgttg ggaaaacttt gtgtacaatg ataatgagcc attcaagcct tggaagggat taaaaaccaa ctttcgactt ctgaaaagaa ggctacggga gagtctccag tga. It is sometimes possible for the material contained within the vial of "APOBEC3C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.