Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOA1 cdna clone

APOA1 cDNA Clone

Gene Names
APOA1; apo(a)
Synonyms
APOA1; APOA1 cDNA Clone; APOA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagctgcggtgctgaccttggccgtgctcttcctgacggggagccaggctcggcatttctggcagcaagatgaacccccccagagcccctgggatcgagtgaaggacctggccactgtgtacgtggatgtgctcaaagacagcggcagagactatgtgtcccagtttgaaggctccgccttgggaaaacagctaaacctaaagctccttgacaactgggacagcgtgacctccaccttcagcaagctgcgcgaacagctcggccctgtgacccaggagttctgggataacctggaaaaggagacagagggcctgaggcaggagatgagcaaggatctggaggaggtgaaggccaaggtgcagccctacctggacgacttccagaagaagtggcaggaggagatggagctctaccgccagaaggtggagccgctgcgcgcagagctccaagagggcgcgcgccagaagctgcacgagctgcaagagaagctgagcccactgggcgaggagatgcgcgaccgcgcgcgcgcccatgtggacgcgctgcgcacgcatctggccccctacagcgacgagctgcgccagcgcttggccgcgcgccttgaggctctcaaggagaacggcggcgccagactggccgagtaccacgccaaggccaccgagcatctgagcacgctcagcgagaaggccaagcccgcgctcgaggacctccgccaaggcctgctgcccgtgctggagagcttcaaggtcagcttcctgagcgctctcgaggagtacactaagaagctcaacacccagtga
Sequence Length
804
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
335
Molecular Weight
30,778 Da
NCBI Official Full Name
Homo sapiens apolipoprotein A-I, mRNA
NCBI Official Synonym Full Names
apolipoprotein A1
NCBI Official Symbol
APOA1
NCBI Official Synonym Symbols
apo(a)
NCBI Protein Information
apolipoprotein A-I
UniProt Protein Name
Apolipoprotein A-I
Protein Family
UniProt Gene Name
APOA1
UniProt Synonym Gene Names
Apo-AI; ApoA-I; ProapoA-I
UniProt Entry Name
APOA1_HUMAN

NCBI Description

This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. The encoded preproprotein is proteolytically processed to generate the mature protein, which promotes cholesterol efflux from tissues to the liver for excretion, and is a cofactor for lecithin cholesterolacyltransferase (LCAT), an enzyme responsible for the formation of most plasma cholesteryl esters. This gene is closely linked with two other apolipoprotein genes on chromosome 11. Defects in this gene are associated with HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein. [provided by RefSeq, Dec 2015]

Uniprot Description

APOA1: Participates in the reverse transport of cholesterol from tissues to the liver for excretion by promoting cholesterol efflux from tissues and by acting as a cofactor for the lecithin cholesterol acyltransferase (LCAT). As part of the SPAP complex, activates spermatozoa motility. Interacts with APOA1BP and CLU. Component of a sperm activating protein complex (SPAP), consisting of APOA1, an immunoglobulin heavy chain, an immunoglobulin light chain and albumin. Interacts with NDRG1. Major protein of plasma HDL, also found in chylomicrons. Synthesized in the liver and small intestine. The oxidized form at Met-110 and Met-136 is increased in individuals with increased risk for coronary artery disease, such as in carrier of the eNOSa/b genotype and exposure to cigarette smoking. It is also present in increased levels in aortic lesions relative to native ApoA-I and increased levels are seen with increasing severity of disease. Belongs to the apolipoprotein A1/A4/E family.

Protein type: Lipid-binding; Secreted, signal peptide; Vesicle; Motility/polarity/chemotaxis; Secreted; Endoplasmic reticulum; Cell development/differentiation

Chromosomal Location of Human Ortholog: 11q23-q24

Cellular Component: chylomicron; cytoplasmic vesicle; cytosol; early endosome; endocytic vesicle; endoplasmic reticulum lumen; extracellular region; extracellular space; plasma membrane

Molecular Function: apolipoprotein A-I receptor binding; apolipoprotein receptor binding; beta-amyloid binding; chemorepellent activity; cholesterol binding; cholesterol transporter activity; enzyme binding; identical protein binding; phosphatidylcholine binding; phospholipid binding; protein binding

Biological Process: cellular protein metabolic process; cholesterol biosynthetic process; cholesterol efflux; cholesterol homeostasis; cholesterol metabolic process; cholesterol transport; G-protein coupled receptor protein signaling pathway; integrin-mediated signaling pathway; lipoprotein biosynthetic process; lipoprotein metabolic process; negative chemotaxis; negative regulation of cytokine secretion during immune response; negative regulation of heterotypic cell-cell adhesion; negative regulation of inflammatory response; negative regulation of interleukin-1 beta secretion; neurite regeneration; peptidyl-methionine modification; phosphatidylcholine biosynthetic process; phospholipid efflux; phospholipid homeostasis; platelet degranulation; positive regulation of fatty acid biosynthetic process; positive regulation of hydrolase activity; positive regulation of lipoprotein lipase activity; positive regulation of Rho protein signal transduction; positive regulation of stress fiber formation; protein amino acid oxidation; protein stabilization; receptor-mediated endocytosis; regulation of Cdc42 protein signal transduction; regulation of cholesterol absorption; retinoid metabolic process; reverse cholesterol transport; transforming growth factor beta receptor signaling pathway; transmembrane transport; triacylglycerol catabolic process; vitamin transport

Disease: Amyloidosis, Familial Visceral; Hypoalphalipoproteinemia, Primary

Research Articles on APOA1

Similar Products

Product Notes

The APOA1 apoa1 (Catalog #AAA1278074) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagctg cggtgctgac cttggccgtg ctcttcctga cggggagcca ggctcggcat ttctggcagc aagatgaacc cccccagagc ccctgggatc gagtgaagga cctggccact gtgtacgtgg atgtgctcaa agacagcggc agagactatg tgtcccagtt tgaaggctcc gccttgggaa aacagctaaa cctaaagctc cttgacaact gggacagcgt gacctccacc ttcagcaagc tgcgcgaaca gctcggccct gtgacccagg agttctggga taacctggaa aaggagacag agggcctgag gcaggagatg agcaaggatc tggaggaggt gaaggccaag gtgcagccct acctggacga cttccagaag aagtggcagg aggagatgga gctctaccgc cagaaggtgg agccgctgcg cgcagagctc caagagggcg cgcgccagaa gctgcacgag ctgcaagaga agctgagccc actgggcgag gagatgcgcg accgcgcgcg cgcccatgtg gacgcgctgc gcacgcatct ggccccctac agcgacgagc tgcgccagcg cttggccgcg cgccttgagg ctctcaagga gaacggcggc gccagactgg ccgagtacca cgccaaggcc accgagcatc tgagcacgct cagcgagaag gccaagcccg cgctcgagga cctccgccaa ggcctgctgc ccgtgctgga gagcttcaag gtcagcttcc tgagcgctct cgaggagtac actaagaagc tcaacaccca gtga. It is sometimes possible for the material contained within the vial of "APOA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.