Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP3M2 cdna clone

AP3M2 cDNA Clone

Gene Names
AP3M2; P47B; AP47B; CLA20
Synonyms
AP3M2; AP3M2 cDNA Clone; AP3M2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatccatagtcttttcttgatcaactcctctggagacattttcctggagaaacattggaaaagtgtggtcagccgttctgtttgtgattacttttttgaggcgcaagagagagctactgaggcagaaaatgtgcctccggttatccctacccctcaccactatctcttaagtgtttaccgccacaagatcttttttgtggccgtgatccagacggaggtcccccctctgtttgtcattgagtttcttcaccgagtggtggacacatttcaggattattttggagtctgttcagagccagtgatcaaagacaatgtagttgtggtttatgaggtattggaagagatgcttgacaatggttttccattggctaccgagtcgaacattcttaaagaactcataaagcctcctaccatccttcgaacggttgtcaacaccatcacaggaagcacgaatgtgggtgaccagcttcccactgggcagctgtcagtggtgccttggcgacggactggggtgaaatataccaacaatgaggcctattttgatgtgattgaagagattgatgcaattattgataaatcaggctccacaattactgctgagatccagggggtgattgatgcctgtgtcaagctgactggcatgccagaccttacactttccttcatgaaccctaggttgttggatgatgtcagcttccatccttgtgttcgtttcaaacgctgggaatctgagcgcatcctctccttcatccctcctgatggaaacttccgcctgctgtcttaccatgtcagtgcacagaaatgctgtcttgggatgtag
Sequence Length
822
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,957 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 3, mu 2 subunit, mRNA
NCBI Official Synonym Full Names
adaptor related protein complex 3 mu 2 subunit
NCBI Official Symbol
AP3M2
NCBI Official Synonym Symbols
P47B; AP47B; CLA20
NCBI Protein Information
AP-3 complex subunit mu-2
UniProt Protein Name
AP-3 complex subunit mu-2
Protein Family
UniProt Gene Name
AP3M2
UniProt Entry Name
AP3M2_HUMAN

NCBI Description

This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]

Uniprot Description

AP3M2: Part of the AP-3 complex, an adaptor-related complex which is not clathrin-associated. The complex is associated with the Golgi region as well as more peripheral structures. It facilitates the budding of vesicles from the Golgi membrane and may be directly involved in trafficking to lysosomes. Belongs to the adaptor complexes medium subunit family.

Chromosomal Location of Human Ortholog: 8p11.2

Cellular Component: AP-type membrane coat adaptor complex

Biological Process: anterograde axon cargo transport; anterograde synaptic vesicle transport

Research Articles on AP3M2

Similar Products

Product Notes

The AP3M2 ap3m2 (Catalog #AAA1275844) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccata gtcttttctt gatcaactcc tctggagaca ttttcctgga gaaacattgg aaaagtgtgg tcagccgttc tgtttgtgat tacttttttg aggcgcaaga gagagctact gaggcagaaa atgtgcctcc ggttatccct acccctcacc actatctctt aagtgtttac cgccacaaga tcttttttgt ggccgtgatc cagacggagg tcccccctct gtttgtcatt gagtttcttc accgagtggt ggacacattt caggattatt ttggagtctg ttcagagcca gtgatcaaag acaatgtagt tgtggtttat gaggtattgg aagagatgct tgacaatggt tttccattgg ctaccgagtc gaacattctt aaagaactca taaagcctcc taccatcctt cgaacggttg tcaacaccat cacaggaagc acgaatgtgg gtgaccagct tcccactggg cagctgtcag tggtgccttg gcgacggact ggggtgaaat ataccaacaa tgaggcctat tttgatgtga ttgaagagat tgatgcaatt attgataaat caggctccac aattactgct gagatccagg gggtgattga tgcctgtgtc aagctgactg gcatgccaga ccttacactt tccttcatga accctaggtt gttggatgat gtcagcttcc atccttgtgt tcgtttcaaa cgctgggaat ctgagcgcat cctctccttc atccctcctg atggaaactt ccgcctgctg tcttaccatg tcagtgcaca gaaatgctgt cttgggatgt ag. It is sometimes possible for the material contained within the vial of "AP3M2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.