Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP2A2 cdna clone

AP2A2 cDNA Clone

Gene Names
AP2A2; HIP9; HYPJ; ADTAB; HIP-9; CLAPA2
Synonyms
AP2A2; AP2A2 cDNA Clone; AP2A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggccgtgtccaagggggacgggatgcggggcctggcggtcttcatctcggatatccgcaactgtaaaagtaaagaagcagaaataaaaaggataaacaaggaactggcaaatatcagatcaaaatttaaaggtgacaaggctcttgatggctatagtaaaaaaaagtacgtctgcaagttgctcttcatctttctccttggtcatgacattgactttggacacatggaggctgtgaacctgctgagttcaaacagatacacggaaaagcagatcggctaccttttcatctctgtgttggtgaactcaaacagtgagctgatccgcctgatcaacaacgccatcaagaatgacctggccagccgcaaccccaccttcatgggcctggccctgcactgcatcgccagcgtgggcagccgggagatggccgaggccttcgccggggagatccctaaggtcctcgtagccggagacactatggacagcgtgaagcagagcgcggccctgtgcttgctgcgcctgtacaggacgtcccccgatcttgtccccatgggcgactggacatcccgagtggtgcacctgctcaatgaccagcacttgggtgtggtaactgcagccacaagtctgatcaccactttagcacagaagaacccagaagagtttaaaacctccgtgtctctggctgtctctaggctaagcagaatcgtgacgtctgcatccacagatctccaggattacacttactattttgtcccggctccctggctgtctgtcaaactgctgagactgctgcagtgctacccacccccagaccctgcagtgcgaggccgcctgactgagtgcctggagaccatcctgaacaaagcccaagaaccgcccaagtcgaagaaggtccagcactccaacgcgaagaatgccgtgctcttcgaggccatcagcttaatcattcaccatgacagtgagccgaacctgctcgtccgtgcctgcaaccagttgggccagtttctgcagcaccgcgagaccaacctgcgctacctggccctggagagcatgtgcacgctggccagctctgagttctcccatgaggctgtcaagacgcacatcgagacggtcatcaacgccctgaagactgagcgggacgtgagcgtgcggcagcgggccgtggacctcctctacgccatgtgcgaccgcagcaacgccccacagatcgtggccgagatgctgagctatctggagacagctgactactccatccgagaagagattgtgctgaaggtcgccatcctggctgagaagtacgcggtggactacacctggtatgtggataccatcttgaacttgatccgaattgctggtgattacgtgagtgaagaggtgtggtaccgagtcattcagatcgtcatcaaccgggacgacgtgcagggctacgcggccaagactgtgttcgaggctcttcaggctcccgcgtgccacgagaacctggtcaaagtgggcggctacatcctgggggagtttggaaacttgatagctggagacccgagatccagcccgctgatccagttccacctgctgcactccaagttccacctgtgcagcgtccccacccgcgcgctgctcctgtccacctacatcaagttcgtgaacctcttcccggaggtgaagcccaccatccaggacgtgctgcgcagcgacagccagctcaggaacgcagacgtggagctgcagcagcgtgctgtggagtacctgcggctcagcaccgtggccagcaccgacattctggcgaccgtgctggaggagatgcccccattcccggagcgggagtcctccatcttggcaaagctcaagaagaagaagggccccagcacggtgacagacctggaggacaccaagcgggacaggagtgtggacgtgaacgggggtcctgagcctgccccagccagtaccagcgccgtgtctacgccttctccgtcggcagacctgctgggtctcggggctgccccccctgcccccgcgggccccccaccctcctccggcggcagcgggctgctcgtggacgtgttctcagactcggcctctgtggtcgcgcctctcgctcctggctccgaagacaactttgccaggtttgtttgtaaaaacaatggtgtgttgtttgaaaaccagctgcttcaaattggacttaagtctgaatttcggcagaatttaggtcggatgtttatcttttatggtaataagacctccacgcagttcctaaactttaccccaacactaatctgttcagacgaccttcagcctaacctgaacctgcagaccaagcccgtggacccgaccgtggaggggggcgcgcaggtgcagcaggtggtcaacatagagtgcgtgtccgacttcacggaggcgccagtcctcaacattcagttcaggtatgggggcaccttccagaacgtgtctgtgcagctgcccatcactctcaacaaattcttccagccgacagaaatggcttctcaggatttctttcaacgttggaagcagttgagcaatccacagcaggaagtgcagaacatcttcaaagcaaagcacccaatggacacagaagtcaccaaagccaagatcattggatttggttctgcacttcttgaagaagttgatcctaatcctgcgaatttcgtgggagctggaatcatccacacgaaaaccacccagattggatgcctgctgcgcttggagccgaacctgcaagcccagatgtaccggctcacgctgcgcacaagtaaggaagccgtttctcagagattatgtgaattgctctcagcgcagttttag
Sequence Length
2820
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
161
Molecular Weight
73,128 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 2, alpha 2 subunit, mRNA
NCBI Official Synonym Full Names
adaptor related protein complex 2 alpha 2 subunit
NCBI Official Symbol
AP2A2
NCBI Official Synonym Symbols
HIP9; HYPJ; ADTAB; HIP-9; CLAPA2
NCBI Protein Information
AP-2 complex subunit alpha-2
UniProt Protein Name
AP-2 complex subunit alpha-2
Protein Family
UniProt Gene Name
AP2A2
UniProt Synonym Gene Names
ADTAB; CLAPA2; HIP9; HYPJ; KIAA0899; HIP-9
UniProt Entry Name
AP2A2_HUMAN

Uniprot Description

AP2A2: Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin- coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. The AP-2 alpha subunit binds polyphosphoinositide-containing lipids, positioning AP-2 on the membrane. The AP-2 alpha subunit acts via its C- terminal appendage domain as a scaffolding platform for endocytic accessory proteins. The AP-2 alpha and AP-2 sigma subunits are thought to contribute to the recognition of the [ED]-X-X-X-L-[LI] motif. Belongs to the adaptor complexes large subunit family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: AP-2 adaptor complex; cytoplasmic membrane-bound vesicle; cytosol; plasma membrane

Molecular Function: protein binding; protein kinase binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; ephrin receptor signaling pathway; microtubule-based movement; negative regulation of epidermal growth factor receptor signaling pathway; regulation of defense response to virus by virus; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on AP2A2

Similar Products

Product Notes

The AP2A2 ap2a2 (Catalog #AAA1274901) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggccg tgtccaaggg ggacgggatg cggggcctgg cggtcttcat ctcggatatc cgcaactgta aaagtaaaga agcagaaata aaaaggataa acaaggaact ggcaaatatc agatcaaaat ttaaaggtga caaggctctt gatggctata gtaaaaaaaa gtacgtctgc aagttgctct tcatctttct ccttggtcat gacattgact ttggacacat ggaggctgtg aacctgctga gttcaaacag atacacggaa aagcagatcg gctacctttt catctctgtg ttggtgaact caaacagtga gctgatccgc ctgatcaaca acgccatcaa gaatgacctg gccagccgca accccacctt catgggcctg gccctgcact gcatcgccag cgtgggcagc cgggagatgg ccgaggcctt cgccggggag atccctaagg tcctcgtagc cggagacact atggacagcg tgaagcagag cgcggccctg tgcttgctgc gcctgtacag gacgtccccc gatcttgtcc ccatgggcga ctggacatcc cgagtggtgc acctgctcaa tgaccagcac ttgggtgtgg taactgcagc cacaagtctg atcaccactt tagcacagaa gaacccagaa gagtttaaaa cctccgtgtc tctggctgtc tctaggctaa gcagaatcgt gacgtctgca tccacagatc tccaggatta cacttactat tttgtcccgg ctccctggct gtctgtcaaa ctgctgagac tgctgcagtg ctacccaccc ccagaccctg cagtgcgagg ccgcctgact gagtgcctgg agaccatcct gaacaaagcc caagaaccgc ccaagtcgaa gaaggtccag cactccaacg cgaagaatgc cgtgctcttc gaggccatca gcttaatcat tcaccatgac agtgagccga acctgctcgt ccgtgcctgc aaccagttgg gccagtttct gcagcaccgc gagaccaacc tgcgctacct ggccctggag agcatgtgca cgctggccag ctctgagttc tcccatgagg ctgtcaagac gcacatcgag acggtcatca acgccctgaa gactgagcgg gacgtgagcg tgcggcagcg ggccgtggac ctcctctacg ccatgtgcga ccgcagcaac gccccacaga tcgtggccga gatgctgagc tatctggaga cagctgacta ctccatccga gaagagattg tgctgaaggt cgccatcctg gctgagaagt acgcggtgga ctacacctgg tatgtggata ccatcttgaa cttgatccga attgctggtg attacgtgag tgaagaggtg tggtaccgag tcattcagat cgtcatcaac cgggacgacg tgcagggcta cgcggccaag actgtgttcg aggctcttca ggctcccgcg tgccacgaga acctggtcaa agtgggcggc tacatcctgg gggagtttgg aaacttgata gctggagacc cgagatccag cccgctgatc cagttccacc tgctgcactc caagttccac ctgtgcagcg tccccacccg cgcgctgctc ctgtccacct acatcaagtt cgtgaacctc ttcccggagg tgaagcccac catccaggac gtgctgcgca gcgacagcca gctcaggaac gcagacgtgg agctgcagca gcgtgctgtg gagtacctgc ggctcagcac cgtggccagc accgacattc tggcgaccgt gctggaggag atgcccccat tcccggagcg ggagtcctcc atcttggcaa agctcaagaa gaagaagggc cccagcacgg tgacagacct ggaggacacc aagcgggaca ggagtgtgga cgtgaacggg ggtcctgagc ctgccccagc cagtaccagc gccgtgtcta cgccttctcc gtcggcagac ctgctgggtc tcggggctgc cccccctgcc cccgcgggcc ccccaccctc ctccggcggc agcgggctgc tcgtggacgt gttctcagac tcggcctctg tggtcgcgcc tctcgctcct ggctccgaag acaactttgc caggtttgtt tgtaaaaaca atggtgtgtt gtttgaaaac cagctgcttc aaattggact taagtctgaa tttcggcaga atttaggtcg gatgtttatc ttttatggta ataagacctc cacgcagttc ctaaacttta ccccaacact aatctgttca gacgaccttc agcctaacct gaacctgcag accaagcccg tggacccgac cgtggagggg ggcgcgcagg tgcagcaggt ggtcaacata gagtgcgtgt ccgacttcac ggaggcgcca gtcctcaaca ttcagttcag gtatgggggc accttccaga acgtgtctgt gcagctgccc atcactctca acaaattctt ccagccgaca gaaatggctt ctcaggattt ctttcaacgt tggaagcagt tgagcaatcc acagcaggaa gtgcagaaca tcttcaaagc aaagcaccca atggacacag aagtcaccaa agccaagatc attggatttg gttctgcact tcttgaagaa gttgatccta atcctgcgaa tttcgtggga gctggaatca tccacacgaa aaccacccag attggatgcc tgctgcgctt ggagccgaac ctgcaagccc agatgtaccg gctcacgctg cgcacaagta aggaagccgt ttctcagaga ttatgtgaat tgctctcagc gcagttttag. It is sometimes possible for the material contained within the vial of "AP2A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.