Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AP2A1 cdna clone

AP2A1 cDNA Clone

Gene Names
AP2A1; ADTAA; CLAPA1; AP2-ALPHA
Synonyms
AP2A1; AP2A1 cDNA Clone; AP2A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggccgtgtccaagggcgatgggatgcgggggctcgcggtgttcatctccgacatccggaactgtaagagcaaagaggcggaaattaagagaatcaacaaggaactggccaacatccgctccaagttcaaaggagacaaagccttggatggctacagtaagaaaaaatatgtgtgtaaactgcttttcatcttcctgcttggccatgacattgactttgggcacatggaggctgtgaatctgttgagttccaataaatacacagagaagcaaataggttacctgttcatttctgtgctggtgaactcgaactcggagctgatccgcctcatcaacaacgccatcaagaatgacctggccagccgcaaccccaccttcatgtgcctggccctgcactgcatcgccaacgtgggcagccgggagatgggcgaggcctttgccgctgacatcccccgcatcctggtggccggggacagcatggacagtgtcaagcagagtgcggccctgtgcctccttcgactgtacaaggcctcgcctgacctggtgcccatgggcgagtggacggcgcgtgtggtacacctgctcaatgaccagcacatgggtgtggtcacggccgccgtcagcctcatcacctgtctctgcaagaagaacccagatgacttcaagacgtgcgtctctctggctgtgtcgcgcctgagccggatcgtctcctctgcctccaccgacctccaggactacacctactacttcgtcccagcaccctggctctcggtgaagctcctgcggctgctgcagtgctacccgcttccagaggatgcggctgtgaaggggcggctggtggaatgtctggagactgtgctcaacaaggcccaggagccccccaaatccaagaaggtgcagcattccaacgccaagaacgccatcctcttcgagaccatcagcctcatcatccactatgacagtgagcccaacctcctggttcgggcctgcaaccagctgggccagttcctgcagcaccgggagaccaacctgcgctacctggccctggagagcatgtgcacgctggccagctccgagttctcccatgaagccgtcaagacgcacattgacaccgtcatcaatgccctcaagacggagcgggacgtcagcgtgcggcagcgggcggctgacctcctctacgccatgtgtgaccggagcaatgccaagcagatcgtgtcggagatgctgcggtacctggagacggcagactacgccatccgcgaggagatcgtcctgaaggtggccatcctggccgagaagtacgccgtggactacagctggtacgtggacaccatcctcaacctcatccgcattgcgggcgactacgtgagtgaggaggtgtggtaccgtgtgctacagatcgtcaccaaccgtgatgacgtccagggctatgccgccaagaccgtctttgaggcgctccaggcccctgcctgtcacgagaacatggtgaaggttggcggctacatccttggggagtttgggaacctgattgctggggacccccgctccagccccccagtgcagttctccctgctccactccaagttccatctgtgcagcgtggccacgcgggcgctgctgctgtccacctacatcaagttcatcaacctcttccccgagaccaaggccaccatccagggcgtcctgcgggccggctcccagctgcgcaatgctgacgtggagctgcagcagcgagccgtggagtacctcaccctcagctcagtggccagcaccgacgtcctggccacggtgctggaggagatgccgcccttccccgagcgcgagtcgtccatcctggccaagctgaaacgcaagaaggggccaggggccggcagcgccctggacgatggccggagggaccccagcagcaacgacatcaacgggggcatggagcccacccccagcactgtgtcgacgccctcgccctccgccgacctcctggggctgcgggcagcccctcccccggcagcacccccggcttctgcaggagcagggaaccttctggtggacgtcttcgatggcccggccgcccagcccagcctggggcccacccccgaggaggccttcctcagcccaggtcctgaggacatcggccctcccattccggaagccgatgagttgctgaataagtttgtgtgtaagaacaacggggtcctgttcgagaaccagctgctgcagatcggagtcaagtcagagttccgacagaacctgggccgcatgtatctcttctatggcaacaagacctcggtgcagttccagaatttctcacccactgtggttcacccgggagacctccagactcagctggctgtgcagaccaagcgcgtggcggcgcaggtggacggcggcgcgcaggtgcagcaggtgctcaatatcgagtgcctgcgggacttcctgacgcccccgctgctgtccgtgcgcttccggtacggtggcgccccccaggccctcaccctgaagctcccagtgaccatcaacaagttcttccagcccaccgagatggcggcccaggatttcttccagcgctggaagcagctgagcctccctcaacaggaggcgcagaaaatcttcaaagccaaccaccccatggacgcagaagttactaaggccaagcttctggggtttggctctgctctcctggacaatgtggaccccaaccctggtgacagagaagacaccagggtttgggggatgcctgggactttcctccggccttttgtatttttatttttgttcatctgctgctgtttacattctggggggttagggggagtccccctccctccctttcccccccaagcacagaggggagaggggccagggaagtggatgtctcctcccctcccaccccaccctgttgtagcccctcctaccccctccccatccaggggctgtgtattattgtga
Sequence Length
2949
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
160
Molecular Weight
105,361 Da
NCBI Official Full Name
Homo sapiens adaptor-related protein complex 2, alpha 1 subunit, mRNA
NCBI Official Synonym Full Names
adaptor related protein complex 2 alpha 1 subunit
NCBI Official Symbol
AP2A1
NCBI Official Synonym Symbols
ADTAA; CLAPA1; AP2-ALPHA
NCBI Protein Information
AP-2 complex subunit alpha-1
UniProt Protein Name
AP-2 complex subunit alpha-1
Protein Family
UniProt Gene Name
AP2A1
UniProt Synonym Gene Names
ADTAA; CLAPA1
UniProt Entry Name
AP2A1_HUMAN

NCBI Description

This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

AP2A1: Component of the adaptor protein complex 2 (AP-2). Adaptor protein complexes function in protein transport via transport vesicles in different membrane traffic pathways. Adaptor protein complexes are vesicle coat components and appear to be involved in cargo selection and vesicle formation. AP-2 is involved in clathrin-dependent endocytosis in which cargo proteins are incorporated into vesicles surrounded by clathrin (clathrin- coated vesicles, CCVs) which are destined for fusion with the early endosome. The clathrin lattice serves as a mechanical scaffold but is itself unable to bind directly to membrane components. Clathrin-associated adaptor protein (AP) complexes which can bind directly to both the clathrin lattice and to the lipid and protein components of membranes are considered to be the major clathrin adaptors contributing the CCV formation. AP-2 also serves as a cargo receptor to selectively sort the membrane proteins involved in receptor-mediated endocytosis. AP-2 seems to play a role in the recycling of synaptic vesicle membranes from the presynaptic surface. AP-2 recognizes Y-X-X-[FILMV] (Y-X-X-Phi) and [ED]-X-X-X-L-[LI] endocytosis signal motifs within the cytosolic tails of transmembrane cargo molecules. AP-2 may also play a role in maintaining normal post-endocytic trafficking through the ARF6-regulated, non-clathrin pathway. The AP-2 alpha subunit binds polyphosphoinositide-containing lipids, positioning AP-2 on the membrane. The AP-2 alpha subunit acts via its C- terminal appendage domain as a scaffolding platform for endocytic accessory proteins. The AP-2 alpha and AP-2 sigma subunits are thought to contribute to the recognition of the [ED]-X-X-X-L-[LI] motif. Belongs to the adaptor complexes large subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: AP-2 adaptor complex; cytosol; membrane; plasma membrane

Molecular Function: protein binding; protein kinase binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; ephrin receptor signaling pathway; microtubule-based movement; negative regulation of epidermal growth factor receptor signaling pathway; regulation of defense response to virus by virus; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on AP2A1

Similar Products

Product Notes

The AP2A1 ap2a1 (Catalog #AAA1277493) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggccg tgtccaaggg cgatgggatg cgggggctcg cggtgttcat ctccgacatc cggaactgta agagcaaaga ggcggaaatt aagagaatca acaaggaact ggccaacatc cgctccaagt tcaaaggaga caaagccttg gatggctaca gtaagaaaaa atatgtgtgt aaactgcttt tcatcttcct gcttggccat gacattgact ttgggcacat ggaggctgtg aatctgttga gttccaataa atacacagag aagcaaatag gttacctgtt catttctgtg ctggtgaact cgaactcgga gctgatccgc ctcatcaaca acgccatcaa gaatgacctg gccagccgca accccacctt catgtgcctg gccctgcact gcatcgccaa cgtgggcagc cgggagatgg gcgaggcctt tgccgctgac atcccccgca tcctggtggc cggggacagc atggacagtg tcaagcagag tgcggccctg tgcctccttc gactgtacaa ggcctcgcct gacctggtgc ccatgggcga gtggacggcg cgtgtggtac acctgctcaa tgaccagcac atgggtgtgg tcacggccgc cgtcagcctc atcacctgtc tctgcaagaa gaacccagat gacttcaaga cgtgcgtctc tctggctgtg tcgcgcctga gccggatcgt ctcctctgcc tccaccgacc tccaggacta cacctactac ttcgtcccag caccctggct ctcggtgaag ctcctgcggc tgctgcagtg ctacccgctt ccagaggatg cggctgtgaa ggggcggctg gtggaatgtc tggagactgt gctcaacaag gcccaggagc cccccaaatc caagaaggtg cagcattcca acgccaagaa cgccatcctc ttcgagacca tcagcctcat catccactat gacagtgagc ccaacctcct ggttcgggcc tgcaaccagc tgggccagtt cctgcagcac cgggagacca acctgcgcta cctggccctg gagagcatgt gcacgctggc cagctccgag ttctcccatg aagccgtcaa gacgcacatt gacaccgtca tcaatgccct caagacggag cgggacgtca gcgtgcggca gcgggcggct gacctcctct acgccatgtg tgaccggagc aatgccaagc agatcgtgtc ggagatgctg cggtacctgg agacggcaga ctacgccatc cgcgaggaga tcgtcctgaa ggtggccatc ctggccgaga agtacgccgt ggactacagc tggtacgtgg acaccatcct caacctcatc cgcattgcgg gcgactacgt gagtgaggag gtgtggtacc gtgtgctaca gatcgtcacc aaccgtgatg acgtccaggg ctatgccgcc aagaccgtct ttgaggcgct ccaggcccct gcctgtcacg agaacatggt gaaggttggc ggctacatcc ttggggagtt tgggaacctg attgctgggg acccccgctc cagcccccca gtgcagttct ccctgctcca ctccaagttc catctgtgca gcgtggccac gcgggcgctg ctgctgtcca cctacatcaa gttcatcaac ctcttccccg agaccaaggc caccatccag ggcgtcctgc gggccggctc ccagctgcgc aatgctgacg tggagctgca gcagcgagcc gtggagtacc tcaccctcag ctcagtggcc agcaccgacg tcctggccac ggtgctggag gagatgccgc ccttccccga gcgcgagtcg tccatcctgg ccaagctgaa acgcaagaag gggccagggg ccggcagcgc cctggacgat ggccggaggg accccagcag caacgacatc aacgggggca tggagcccac ccccagcact gtgtcgacgc cctcgccctc cgccgacctc ctggggctgc gggcagcccc tcccccggca gcacccccgg cttctgcagg agcagggaac cttctggtgg acgtcttcga tggcccggcc gcccagccca gcctggggcc cacccccgag gaggccttcc tcagcccagg tcctgaggac atcggccctc ccattccgga agccgatgag ttgctgaata agtttgtgtg taagaacaac ggggtcctgt tcgagaacca gctgctgcag atcggagtca agtcagagtt ccgacagaac ctgggccgca tgtatctctt ctatggcaac aagacctcgg tgcagttcca gaatttctca cccactgtgg ttcacccggg agacctccag actcagctgg ctgtgcagac caagcgcgtg gcggcgcagg tggacggcgg cgcgcaggtg cagcaggtgc tcaatatcga gtgcctgcgg gacttcctga cgcccccgct gctgtccgtg cgcttccggt acggtggcgc cccccaggcc ctcaccctga agctcccagt gaccatcaac aagttcttcc agcccaccga gatggcggcc caggatttct tccagcgctg gaagcagctg agcctccctc aacaggaggc gcagaaaatc ttcaaagcca accaccccat ggacgcagaa gttactaagg ccaagcttct ggggtttggc tctgctctcc tggacaatgt ggaccccaac cctggtgaca gagaagacac cagggtttgg gggatgcctg ggactttcct ccggcctttt gtatttttat ttttgttcat ctgctgctgt ttacattctg gggggttagg gggagtcccc ctccctccct ttccccccca agcacagagg ggagaggggc cagggaagtg gatgtctcct cccctcccac cccaccctgt tgtagcccct cctaccccct ccccatccag gggctgtgta ttattgtga. It is sometimes possible for the material contained within the vial of "AP2A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.