Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANP32A cdna clone

ANP32A cDNA Clone

Gene Names
ANP32A; LANP; MAPM; PP32; HPPCn; PHAP1; PHAPI; I1PP2A; C15orf1
Synonyms
ANP32A; ANP32A cDNA Clone; ANP32A cdna clone
Ordering
For Research Use Only!
Sequence
ATGGAGATGGGCAGACGGATTCATTTAGAGCTGCGGAACAGGACGCCCTCTGATGTGAAAGAACTTGTCCTGGACAACAGTCGGTCGAATGAAGGCAAACTCGAAGGCCTCACAGATGAATTTGAAGAACTGGAATTCTTAAGTACAATCAACGTAGGCCTCACCTCAATCGCAAACTTACCAAAGTTAAACAAACTTAAGAAGCTTGAACTAAGCGATAACAGAGTCTCAGGGGGCCTGGAAGTATTGGCAGAAAAGTGTCCGAACCTCACGCATCTAAATTTAAGTGGCAACAAAATTAAAGACCTCAGCACAATAGAGCCACTGAAAAAGTTAGAAAACCTCAAGAGCTTAGACCTTTTCAATTGCGAGGTAACCAACCTGAACGACTACCGAGAAAATGTGTTCAAGCTCCTCCCGCAACTCACATATCTCGACGGCTATGACCGGGACGACAAGGAGGCCCCTGACTCGGATGCTGAGGGCTACGTGGAGGGCCTGGATGATGAGGAGGAGGATGAGGATGAGGAGGAGTATGATGAAGATGCTCAGGTAGTGGAAGACGAGGAGGACGAGGATGAGGAGGAGGAAGGTGAAGAGGAGGACGTGAGTGGAGAGGAGGAGGAGGATGAAGAAGGTTATAACGATGGAGAGGTAGATGACGAGGAAGATGAAGAAGAGCTTGGTGAAGAAGAAAGGGGTCAGAAGCGAAAATGA
Sequence Length
717
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,585 Da
NCBI Official Full Name
Homo sapiens acidic (leucine-rich) nuclear phosphoprotein 32 family, member A, mRNA
NCBI Official Synonym Full Names
acidic nuclear phosphoprotein 32 family member A
NCBI Official Symbol
ANP32A
NCBI Official Synonym Symbols
LANP; MAPM; PP32; HPPCn; PHAP1; PHAPI; I1PP2A; C15orf1
NCBI Protein Information
acidic leucine-rich nuclear phosphoprotein 32 family member A
UniProt Protein Name
Acidic leucine-rich nuclear phosphoprotein 32 family member A
UniProt Gene Name
ANP32A
UniProt Synonym Gene Names
C15orf1; LANP; MAPM; PHAP1; pp32; LANP; PHAPI
UniProt Entry Name
AN32A_HUMAN

Uniprot Description

ANP32A: Implicated in a number of cellular processes, including proliferation, differentiation, caspase-dependent and caspase- independent apoptosis, suppression of transformation (tumor suppressor), inhibition of protein phosphatase 2A, regulation of mRNA trafficking and stability in association with ELAVL1, and inhibition of acetyltransferases as part of the INHAT (inhibitor of histone acetyltransferases) complex. Plays a role in E4F1- mediated transcriptional repression. Belongs to the ANP32 family.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 15q23

Cellular Component: cytoplasm; endoplasmic reticulum; nucleoplasm; nucleus; perinuclear region of cytoplasm

Molecular Function: protein binding

Biological Process: nucleocytoplasmic transport; regulation of mRNA stability

Research Articles on ANP32A

Similar Products

Product Notes

The ANP32A anp32a (Catalog #AAA1266042) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGAGATGG GCAGACGGAT TCATTTAGAG CTGCGGAACA GGACGCCCTC TGATGTGAAA GAACTTGTCC TGGACAACAG TCGGTCGAAT GAAGGCAAAC TCGAAGGCCT CACAGATGAA TTTGAAGAAC TGGAATTCTT AAGTACAATC AACGTAGGCC TCACCTCAAT CGCAAACTTA CCAAAGTTAA ACAAACTTAA GAAGCTTGAA CTAAGCGATA ACAGAGTCTC AGGGGGCCTG GAAGTATTGG CAGAAAAGTG TCCGAACCTC ACGCATCTAA ATTTAAGTGG CAACAAAATT AAAGACCTCA GCACAATAGA GCCACTGAAA AAGTTAGAAA ACCTCAAGAG CTTAGACCTT TTCAATTGCG AGGTAACCAA CCTGAACGAC TACCGAGAAA ATGTGTTCAA GCTCCTCCCG CAACTCACAT ATCTCGACGG CTATGACCGG GACGACAAGG AGGCCCCTGA CTCGGATGCT GAGGGCTACG TGGAGGGCCT GGATGATGAG GAGGAGGATG AGGATGAGGA GGAGTATGAT GAAGATGCTC AGGTAGTGGA AGACGAGGAG GACGAGGATG AGGAGGAGGA AGGTGAAGAG GAGGACGTGA GTGGAGAGGA GGAGGAGGAT GAAGAAGGTT ATAACGATGG AGAGGTAGAT GACGAGGAAG ATGAAGAAGA GCTTGGTGAA GAAGAAAGGG GTCAGAAGCG AAAATGA. It is sometimes possible for the material contained within the vial of "ANP32A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.