Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKS3 cdna clone

ANKS3 cDNA Clone

Synonyms
ANKS3; ANKS3 cDNA Clone; ANKS3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagacatccagggctggacagccctcttccactgtaccagcgccgggcaccagcacatggtcaggttcctcttggacagtggagccaatgccaacgtgagggagccgatatgtggatttactcccttgatggaagcagctgctgctggccatgagataatcgtgcagtattttctgaatcacggagtcaaggtggacgcgagagaccacagtggagccacagcccggatgctggccaagcagtacggacacatgaagatcgtggccttgatggacacttactcgccctctctgcccaagagcctctatcggagcccagaaaagtacgaagatctgagctcttctgacgagtcctgccctgctcctcagagacagaggccttgccggaagaagggtgtcagcatccacgagggaccgcgagccctggccaggatcacaggcattggcctgggcggcagagccccacggcctcgctatgagcaggctcctccccgtggctatgtcaccttcaacagcagtggcgagaaccccctggaagaagagggcctctgctgccgggatgtcacctcccccatcaatgagcgggacgtggagagcagcagcagcagcagcagtcgggaggaacatgctttctgtgccaacctggggcccgtccagagcagcagcagcagcgagggcctggccagagcccaggggctcagcagcgaagcttctgtggagagcaacgaggactcggatcatgcctgtaaaagctcagctcgcaaacaagctaaaagttacatgaagaccaagaatcctgacagccagtggcctccccgcactgcaactgacagggaaggctttctcgctgagtccagcccccagactcagagggccccctactcaggaccccaggaccttgccgcactgctggagcagatcgggtgtctgaagtacctgcaggtgtttgaggagcaggacgtggacctccgcatctttctgaccctcactgagagcgacctgaaggaaattggcatcacgctgtttgggcccaagaggaagatgacgtccgccattgcccgctggcacagcagtgcccgcccacccggggatgccctggagctggcctacgccgaccggctggaggctgagatgcaagagctcgccatccagctgcacaagcgctgcgaggaggtagaggccacgcggggccaggtgtgtcaggagcaggagctgcgcgccgtggtggagagctgcctgctggagcaggaccgcgcccgcgaggacctccaggcccggctgcgggagacgtgggccctggcccgggatgctgccctcgtcctggaccagctgcgagcctgtcaagctgagctgtcatctcgagtgaggcaggaccagccccctggtgcagccactctgggcctagccgtccccccagctgactccaagggctggcaagcgtccctgcaggccatgagcctccccgagctctcgggagccctggaggaccgtgtccgtgagatggggcaagcactgtgcttagtgacccagagcctggagaagctgcaggtgctgagcgggaagaagtggcgggagacctag
Sequence Length
1584
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,990 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and sterile alpha motif domain containing 3, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and sterile alpha motif domain containing 3
NCBI Official Symbol
ANKS3
NCBI Protein Information
ankyrin repeat and SAM domain-containing protein 3
UniProt Protein Name
Ankyrin repeat and SAM domain-containing protein 3
UniProt Gene Name
ANKS3
UniProt Synonym Gene Names
KIAA1977
UniProt Entry Name
ANKS3_HUMAN

Uniprot Description

ANKS3: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 16p13.3

Research Articles on ANKS3

Similar Products

Product Notes

The ANKS3 anks3 (Catalog #AAA1267466) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagaca tccagggctg gacagccctc ttccactgta ccagcgccgg gcaccagcac atggtcaggt tcctcttgga cagtggagcc aatgccaacg tgagggagcc gatatgtgga tttactccct tgatggaagc agctgctgct ggccatgaga taatcgtgca gtattttctg aatcacggag tcaaggtgga cgcgagagac cacagtggag ccacagcccg gatgctggcc aagcagtacg gacacatgaa gatcgtggcc ttgatggaca cttactcgcc ctctctgccc aagagcctct atcggagccc agaaaagtac gaagatctga gctcttctga cgagtcctgc cctgctcctc agagacagag gccttgccgg aagaagggtg tcagcatcca cgagggaccg cgagccctgg ccaggatcac aggcattggc ctgggcggca gagccccacg gcctcgctat gagcaggctc ctccccgtgg ctatgtcacc ttcaacagca gtggcgagaa ccccctggaa gaagagggcc tctgctgccg ggatgtcacc tcccccatca atgagcggga cgtggagagc agcagcagca gcagcagtcg ggaggaacat gctttctgtg ccaacctggg gcccgtccag agcagcagca gcagcgaggg cctggccaga gcccaggggc tcagcagcga agcttctgtg gagagcaacg aggactcgga tcatgcctgt aaaagctcag ctcgcaaaca agctaaaagt tacatgaaga ccaagaatcc tgacagccag tggcctcccc gcactgcaac tgacagggaa ggctttctcg ctgagtccag cccccagact cagagggccc cctactcagg accccaggac cttgccgcac tgctggagca gatcgggtgt ctgaagtacc tgcaggtgtt tgaggagcag gacgtggacc tccgcatctt tctgaccctc actgagagcg acctgaagga aattggcatc acgctgtttg ggcccaagag gaagatgacg tccgccattg cccgctggca cagcagtgcc cgcccacccg gggatgccct ggagctggcc tacgccgacc ggctggaggc tgagatgcaa gagctcgcca tccagctgca caagcgctgc gaggaggtag aggccacgcg gggccaggtg tgtcaggagc aggagctgcg cgccgtggtg gagagctgcc tgctggagca ggaccgcgcc cgcgaggacc tccaggcccg gctgcgggag acgtgggccc tggcccggga tgctgccctc gtcctggacc agctgcgagc ctgtcaagct gagctgtcat ctcgagtgag gcaggaccag ccccctggtg cagccactct gggcctagcc gtccccccag ctgactccaa gggctggcaa gcgtccctgc aggccatgag cctccccgag ctctcgggag ccctggagga ccgtgtccgt gagatggggc aagcactgtg cttagtgacc cagagcctgg agaagctgca ggtgctgagc gggaagaagt ggcgggagac ctag. It is sometimes possible for the material contained within the vial of "ANKS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.